Acatapaustus mesoleuca

Lower, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nolidae/Acatapaustus

At a glance

Occurrence records139

Data sources5

Biological traits0

DNA specimens14

eDNA detections22

Sources5 archives

Databases and archives Acatapaustus mesoleuca's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF139 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD14 specimens

01Narrative

Acatapaustus basifusca is een vlinder uit de familie van de visstaartjes (Nolidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1904 door Bethune-Baker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acatapaustus mesoleuca has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

16Tmostly conserved

22Tmostly conserved

49Tmostly conserved

55Tmostly conserved

79Tmostly conserved

85Amostly conserved

88Amostly conserved

127Amostly conserved

181Amostly conserved

202Amostly conserved

205Amostly conserved

217Amostly conserved

220Amostly conserved

232Cmostly conserved

268Tmostly conserved

277Amostly conserved

284Cmostly conserved

307Amostly conserved

355Cmostly conserved

370Tmostly conserved

373Tmostly conserved

382Amostly conserved

394Tmostly conserved

400Cmostly conserved

401Cmostly conserved

403Tmostly conserved

412Tmostly conserved

415Tmostly conserved

428Tmostly conserved

430Amostly conserved

433Tmostly conserved

445Cmostly conserved

451Cmostly conserved

484Amostly conserved

494Tmostly conserved

499Tmostly conserved

520Tmostly conserved

526Tmostly conserved

536Cmostly conserved

538Tmostly conserved

547Amostly conserved

550Amostly conserved

556Amostly conserved

568Amostly conserved

581Cmostly conserved

583Tmostly conserved

616Cmostly conserved

619Cmostly conserved

622Amostly conserved

634Tmostly conserved

637Tmostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BINs2

Most divergent pair7.9%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acatapaustus atrinotasame genus6.8%Acraephnes cryeropissame order7.3%Meganola togatulalissame family7.6%Depressaria eryngiellasame order7.8%Acatapaustus metallopasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor131

Museum / vouchered8

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 80≤1 km 37>10 km 4

121 georeferenced · 10 without coordinates

Open the mapobservation + sensor131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tallinn, EE	3

1 institutions · 3 of 8 vouchered records shown · 5 without an institution code

09Environmental DNA22 detections

Where the DNA of Acatapaustus mesoleuca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 19.3–26.2

Seasonal swing summer↔winter5.70 °C

Max temp (day)26.0 °C 23.4–27.8

Min temp (night)22.8 °C 16.5–25.4

Precipitation191 mm/mo 32.6–299

Air humidity66.2 % 62.5–69.9

Moisture balance64.7 mm/mo

Vapour deficit1,049 Pa 758–1,242

Wind speed2.80 m/s

Cloud cover49.7 % 33.5–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)