Acartia tonsa

Dana, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Copepoda/Calanoida/Acartiidae/Acartia

At a glance

Occurrence records14 289

Data sources9

Biological traits5

DNA specimens461

eDNA detections3 234

Sources9 archives

Databases and archives Acartia tonsa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 289 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 234 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics461 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF14 289 records

Environmental DNA22 datasets · 13 countries3 234 detections

DNA & barcodingBOLD461 specimens

Genome at a glanceGoaT · NCBI≈780 Mbp

01Narrative

Acartia tonsa is a species of marine copepod in the family Acartiidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max50 m

Depth min0 m

05DNA & barcoding461 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acartia tonsa has left across the world's sequence archives.

At a glance

DNA specimens461

BINs23

Marker genes1

eDNA detections3 234

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P583 bp consensus313 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 76% of positions are identical in every specimen.

Where individuals differ — all 139 variable positions, in barcode order

5Gmostly conserved

17Tmostly conserved

20Amostly conserved

23Cmostly conserved

26Tvariable

29Amostly conserved

32Amostly conserved

35Amostly conserved

41Tmostly conserved

44Amostly conserved

50Gmostly conserved

51Cmostly conserved

53Tmostly conserved

56Cmostly conserved

59Gvariable

62Tmostly conserved

65Amostly conserved

68Amostly conserved

69Cvariable

71Tvariable

74Cvariable

77Gvariable

83Tmostly conserved

92Tmostly conserved

95Tvariable

98Amostly conserved

101Amostly conserved

104Cvariable

107Cvariable

110Cvariable

113Cmostly conserved

116Tmostly conserved

134Cvariable

137Amostly conserved

140Tmostly conserved

143Amostly conserved

146Amostly conserved

158Amostly conserved

161Amostly conserved

167Amostly conserved

170Tmostly conserved

173Amostly conserved

174Cvariable

179Amostly conserved

189Cmostly conserved

191Amostly conserved

194Gmostly conserved

197Tvariable

203Tmostly conserved

206Amostly conserved

209Tmostly conserved

212Tmostly conserved

215Tmostly conserved

224Tmostly conserved

227Cmostly conserved

230Amostly conserved

240Cmostly conserved

242Gvariable

245Amostly conserved

246Tmostly conserved

251Cmostly conserved

254Avariable

264Cvariable

266Gvariable

272Tmostly conserved

275Amostly conserved

278Gvariable

279Cmostly conserved

287Gvariable

293Gvariable

296Gvariable

299Amostly conserved

302Amostly conserved

305Amostly conserved

311Amostly conserved

314Avariable

317Tvariable

320Cmostly conserved

323Tmostly conserved

324Tmostly conserved

326Amostly conserved

332Cvariable

341Cvariable

347Tmostly conserved

350Amostly conserved

353Gvariable

356Avariable

359Cvariable

362Cmostly conserved

365Tmostly conserved

374Tmostly conserved

377Tmostly conserved

378Cmostly conserved

380Cvariable

383Tvariable

386Tmostly conserved

395Amostly conserved

398Amostly conserved

401Amostly conserved

410Amostly conserved

413Amostly conserved

428Cvariable

431Amostly conserved

437Gvariable

440Tmostly conserved

441Cmostly conserved

443Tmostly conserved

446Amostly conserved

447Tmostly conserved

455Amostly conserved

461Avariable

464Tmostly conserved

470Amostly conserved

473Amostly conserved

476Avariable

479Avariable

485Amostly conserved

494Cvariable

503Avariable

506Amostly conserved

+19 more variable positions not shown

TGTGGTCAGGAATGGTTGGAACCGGTTTAAGAATAATTATTCGAATAGAGCTTGGCCAGGCTGGAAGACTTATCGGGGATGATCAAATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.8%

Haplotypes26

BINs16

Most divergent pair18.5%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acartia hudsonicasame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acartia tonsa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈779 754 176 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acartia tonsa0.78 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness58.5% BUSCO

08Occurrence & distribution

Record type14 289 records

Wild obs. + sensor2 234

Museum / vouchered11 378

Other677

Origin

Native11

Range

Area of Occupancy AOO3 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 32≤1 km 1≤10 km 4

37 georeferenced · 2 197 without coordinates

Open the mapobservation + sensor2 234

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 1 689≤1 km 149≤10 km 13>10 km 36

1 887 georeferenced · 9 491 without coordinates

Open the institutions mapphysical evidence11 378

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
730location not on record	6 655
Centro de Investigación y de Estudios Avanzados, Unidad Irapuato, Instituto Politécnico Nacionallocation not on record	881
UniRosZSlocation not on record	743
Klaipeda University Marine research institutelocation not on record	223
Stockholm, SE	197
CSIRO Oceans and Atmosphere, Australialocation not on record	140
FURGlocation not on record	106
Stanford Universitylocation not on record	74
ONUlocation not on record	47
Vrije Universiteit Brussellocation not on record	44
University of California San Diegolocation not on record	30
Citadel Hill, GB	20
UKRSCESlocation not on record	13
CAJlocation not on record	10
RPlocation not on record	8
Washington, US	8
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	6
Bergen, NO	5
Norwegian Institute of Marine Researchlocation not on record	5
Los Angeles, US	4
ARMS-MBONlocation not on record	4
Ieva Bardalocation not on record	3
DASSHlocation not on record	3
Tapachula, MX	2
Museo de Zoología de la Universidad de Concepción (UCCC_MZUC)location not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Istituto di Scienze Marine di Venezialocation not on record	2
UM-RSMASlocation not on record	1
Cambridge, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Helsinki, FI	1
Centre for Biodiversity Genomicslocation not on record	1
IfAÖ- Institut für Angewandte Ökosystemforschung GmbHlocation not on record	1
SYKE- Okko Outinenlocation not on record	1
University of Oslo (UiO)location not on record	1
IfAÖ Institut für Angewandte Ökosystemforschung GmbHlocation not on record	1

36 institutions · 9 246 of 11 378 vouchered records shown · 2 132 without an institution code

09Environmental DNA3 234 detections

Where the DNA of Acartia tonsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3 234

Studies independent surveys22

Countries13

Verifiable raw sequence linked2 514

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 234 detections have coordinates

Open the map13 countries0

BayLong-Term Ecological Research Site; Marine P…Marine Protected Area; Long-Term Ecological …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C -0.9–18.7

Seasonal swing summer↔winter21.1 °C

Max temp (day)15.4 °C 2.50–21.8

Min temp (night)11.5 °C -4.10–17.1

Precipitation99.5 mm/mo 65.3–136

Air humidity62.8 % 60.5–69.9

Moisture balance64.2 mm/mo

Vapour deficit547 Pa 216–824

Wind speed5.10 m/s

Cloud cover48.0 % 39.2–57.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 957 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acartia tonsa

At a glance

Sources9 archives

Habitat & environment3

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type14 289 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 289 records