Acartia longiremis

(Lilljeborg, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Copepoda/Calanoida/Acartiidae/Acartia

At a glance

Occurrence records50 526

Data sources6

Biological traits2

DNA specimens287

eDNA detections3 699

Sources6 archives

Databases and archives Acartia longiremis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility50 039 records↗

OBISOcean Biodiversity Information System487 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 699 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics287 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS50 526 records

Environmental DNA12 datasets · 10 countries3 699 detections

DNA & barcodingBOLD287 specimens

01Narrative

Acartia longiremis ou Acartia (Acartiura) longiremis est une espèce de copépodes marins de la famille des Acartiidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

05DNA & barcoding287 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acartia longiremis has left across the world's sequence archives.

At a glance

DNA specimens287

BINs2

Marker genes1

eDNA detections3 699

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus208 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 67 variable positions, in barcode order

4Cmostly conserved

16Cmostly conserved

28Amostly conserved

43Tmostly conserved

49Cmostly conserved

50Cmostly conserved

64Cmostly conserved

76Amostly conserved

79Cmostly conserved

91Tmostly conserved

94Amostly conserved

118Tmostly conserved

145Cmostly conserved

163Cmostly conserved

172Tmostly conserved

184Amostly conserved

190Cmostly conserved

202Tmostly conserved

206Cmostly conserved

212Cmostly conserved

226Tmostly conserved

232Cmostly conserved

241Cmostly conserved

259Tmostly conserved

262Amostly conserved

263Tmostly conserved

271Gmostly conserved

283Cmostly conserved

290Cmostly conserved

292Gmostly conserved

304Gmostly conserved

313Cmostly conserved

316Tmostly conserved

328Cmostly conserved

337Tmostly conserved

340Tmostly conserved

343Cmostly conserved

346Tmostly conserved

349Tmostly conserved

367Tmostly conserved

373Tmostly conserved

376Tmostly conserved

379Cmostly conserved

382Amostly conserved

397Tmostly conserved

436Cmostly conserved

451Amostly conserved

466Gmostly conserved

469Cmostly conserved

478Gmostly conserved

487Tmostly conserved

490Cmostly conserved

491Cmostly conserved

499Tmostly conserved

505Tmostly conserved

508Cmostly conserved

514Amostly conserved

532Cmostly conserved

536Tmostly conserved

550Amostly conserved

565Amostly conserved

583Tmostly conserved

607Tmostly conserved

622Amostly conserved

631Amostly conserved

634Tmostly conserved

649Gmostly conserved

AACCTTATATCTTCTCGCCGGGATATGATCAGGGATAGTTGGTACGGGCCTAAGAATAATTATCCGCATAGAGCTAGGCCAAGCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes13

BINs2

Most divergent pair28.1%

N.AmericaEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type50 526 records

Wild obs. + sensor7 116

Museum / vouchered42 778

Other632

Range

Area of Occupancy AOO12 484 km²

Depth

0–200 m sunlit487

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 27.1 m · max 110.7 m · 487 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 122≤1 km 1

123 georeferenced · 6 993 without coordinates

Open the mapobservation + sensor7 116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 474≤1 km 2≤10 km 2>10 km 1

479 georeferenced · 42 299 without coordinates

Open the institutions mapphysical evidence42 778

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
730location not on record	31 455
Citadel Hill, GB	1 423
ArcODlocation not on record	1 278
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	107
Centre for Biodiversity Genomicslocation not on record	70
Bergen, NO	15
The Atlantic reference Centrelocation not on record	14
IPMAlocation not on record	11
Hakai Institutelocation not on record	10
Washington, US	8
JODClocation not on record	6
Norwegian Institute of Marine Researchlocation not on record	5
Maurice Lamontagne Institutelocation not on record	5
BioPlatformslocation not on record	4
IfAÖ Institut für Angewandte Ökosystemforschung GmbHlocation not on record	3
CASlocation not on record	2
Helsinki, FI	2
UGentlocation not on record	2
Ministry of Ports: Official Contact Points for BWMC A-4 Exemptionslocation not on record	2
University of Oslo (UiO)location not on record	1
Edmonton, CA	1
Gothenburg, SE	1
DASSHlocation not on record	1
Saint John, CA	1
Cambridge, US	1
ARMS-MBONlocation not on record	1
SYKE- Okko Outinenlocation not on record	1
PNHSlocation not on record	1

28 institutions · 34 431 of 42 778 vouchered records shown · 7 892 without an institution code

09Environmental DNA3 699 detections

Where the DNA of Acartia longiremis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3 699

Studies independent surveys12

Countries10

Verifiable raw sequence linked2 398

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 699 detections have coordinates

Open the map10 countries0

channelMarina; semi-industrial; 9.3 - Subtidal Loos…water columndocksheltered bay, dockMarine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.6 °C 0–32.2

pH8.11 6.41–8.70

Conductivity49,135 µS/cm 39,843–61,832

Salinity35.4 PSU 30.2–36.3

Dissolved oxygen7.24 mg/L 2.74–11.7

Turbidity0.279 NTU 0.001–73.0

Nitrate1.30 µmol/L 0.009–14.2

Depth20.0 m 0–6,015

Coastal waterPelagic

1 007 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C -5.00–21.4

Seasonal swing summer↔winter23.5 °C

Max temp (day)15.1 °C -0.8–22.5

Min temp (night)8.80 °C -8.40–20.0

Precipitation96.6 mm/mo 37.5–150

Air humidity61.6 % 57.6–66.4

Moisture balance102 mm/mo

Vapour deficit514 Pa 165–1,017

Wind speed5.70 m/s

Cloud cover48.6 % 22.1–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 636 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acartia longiremis

At a glance

Sources6 archives

Habitat & environment2

At a glance

Record type50 526 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type50 526 records