Acartia bifilosa

(Giesbrecht, 1881) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Copepoda/Calanoida/Acartiidae/Acartia

At a glance

Occurrence records43 325

Data sources5

Biological traits2

DNA specimens16

eDNA detections2 813

Sources5 archives

Databases and archives Acartia bifilosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 325 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 813 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF43 325 records

Environmental DNA9 datasets · 6 countries2 813 detections

DNA & barcodingBOLD16 specimens

01Narrative

Acartia bifilosa is een eenoogkreeftjessoort uit de familie van de Acartiidae. De wetenschappelijke naam van de soort is, als Dias bifilosus, voor het eerst geldig gepubliceerd in 1881 door Giesbrecht.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acartia bifilosa has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections2 813

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

259Cvariable

401Cmostly conserved

405Amostly conserved

533Cmostly conserved

598Amostly conserved

AACTTTATATTTATTAGCTGGGATATGGTCTGGCATAGTGGGGACTGGGTTAAGAATAATTATCCGCATAGAGTTAGGGCAAGCGGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes4

BIN1

Most divergent pair0.76%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type43 325 records

Wild obs. + sensor4 039

Museum / vouchered37 566

Other1 720

Range

Area of Occupancy AOO2 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced · 4 035 without coordinates

Open the mapobservation + sensor4 039

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤1 km 26≤10 km 4

30 georeferenced · 37 536 without coordinates

Open the institutions mapphysical evidence37 566

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
730location not on record	29 918
Stockholm, SE	2 318
TÜ_EMIlocation not on record	421
RPlocation not on record	97
ArcODlocation not on record	86
TraFi - Finnish Transport Safety Agencylocation not on record	41
DASSHlocation not on record	36
DOI/NPS, Russel Cave National Monumentlocation not on record	25
IfAÖ Institut für Angewandte Ökosystemforschung GmbHlocation not on record	22
Vrije Universiteit Brussellocation not on record	21
Ieva Bardalocation not on record	5
Helsinki, FI	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
ARMS-MBONlocation not on record	3
Earth Sciences New Zealandlocation not on record	1
SYKE- Okko Outinenlocation not on record	1
UGentlocation not on record	1

17 institutions · 33 003 of 37 566 vouchered records shown · 4 563 without an institution code

09Environmental DNA2 813 detections

Where the DNA of Acartia bifilosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 813

Studies independent surveys9

Countries6

Verifiable raw sequence linked2 792

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 813 detections have coordinates

Open the map6 countries0

Industrial port; industrial; 9.2 - Subtidal …Marine Protected Area; Long-Term Ecological …Long-Term Ecological Research Site; Marine P…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.40 °C 0.8–15.8

Seasonal swing summer↔winter16.9 °C

Max temp (day)8.80 °C 1.80–17.8

Min temp (night)5.40 °C -0.6–13.5

Precipitation54.1 mm/mo 32.5–86.8

Air humidity64.2 % 60.9–66.0

Vapour deficit381 Pa 223–688

Cloud cover51.4 % 40.3–57.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 803 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acartia bifilosa

At a glance

Sources5 archives

Habitat & environment2

At a glance

Record type43 325 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type43 325 records