Acartauchenius scurrilis

(O.Pickard-Cambridge, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Acartauchenius

At a glance

Occurrence records319

Data sources8

Biological traits8

DNA specimens5

eDNA detections2

Sources8 archives

Databases and archives Acartauchenius scurrilis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

World Spider Trait DBMasaryk University8 traits · 25 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements25 literature sources8 traits

Occurrence & distributionGBIF319 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Acartauchenius scurrilis is a species of sheet weaver found in the Palearctic. It was described by O.P.-Cambridge in 1872.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 25 sources

Entling et al. 2007Buchar & Růžička 2002Gajdoš & Svatoň 2001SLU 2020Gajdoš et al. 2014Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Bruun & Lissner 2019Finch 2004Kielhorn 2017Vangsgård et al. 1996Martin 2012Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Noflatscher 1994Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀1.85·♂1.8 mm

Predation1

Hunting guildsheet web weavers

Ecology6

Light0.75 mm

Light 2dark

Moisture 10.5 mm

Moisture 2very dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryGenerally Threatened (G)

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acartauchenius scurrilis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes1

BINs2

Where individuals differ — all 18 variable positions, in barcode order

79Avariable

97Avariable

130Avariable

169Avariable

193Cvariable

281Cvariable

283Avariable

287Cvariable

310Avariable

311Avariable

319Avariable

322Avariable

346Cvariable

385Cvariable

401Tmostly conserved

433Tmostly conserved

622Cvariable

652Cmostly conserved

AAGTTTATATTTTCTTTTTGGAGCTTGAGCTGCAATAGTGGGGACTGCTATAAGTGTATTAATTCGTGTTGAGTTGGGACAAGTTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecynargus morulussame family10.8%Ceratinella brevissame family11.2%Walckenaeria cuspidatasame family11.6%Erigone tirolensissame family11.6%Erigone prominenssame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type319 records

Wild obs. + sensor149

Museum / vouchered170

Origin

Native27

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 38≤1 km 6≤10 km 97>10 km 1

142 georeferenced · 7 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 8≤1 km 9≤10 km 23>10 km 1

41 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence170

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	100
Brussels, BE	14
Provincia di Livornolocation not on record	7
Uniwersytet w Białymstokulocation not on record	5
Geneva, CH	4
Tilburg, NL	3
Musee d'Histoire Naturallelocation not on record	2
NTNU-VMlocation not on record	2
Helsinki, FI	2
Bonn, DE	2
SLU Artdatabankenlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Akademia Pomorska w Słupskulocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Frankfurt am Main	1

17 institutions · 150 of 170 vouchered records shown · 20 without an institution code

09Environmental DNA2 detections

Where the DNA of Acartauchenius scurrilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Ex. Tetramorium caespitum

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.50 °C 4.50–4.50

Seasonal swing summer↔winter16.6 °C

Max temp (day)6.00 °C

Min temp (night)2.90 °C

Precipitation28.8 mm/mo

Air humidity62.1 %

Moisture balance-35.5 mm/mo

Vapour deficit320 Pa

Wind speed4.10 m/s

Cloud cover43.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)