Acarospora stapfiana

(Müll.Arg.) Hue · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Acarosporales/Acarosporaceae/Acarospora

At a glance

Occurrence records180

Data sources6

Biological traits1

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Acarospora stapfiana's data was compiled from.

GBIFGlobal Biodiversity Information Facility180 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF180 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acarospora stapfiana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences7

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMZ243475.1 ↗488 bpUSA

ACGT

CAGAGCTAGGGTCTTCCAGGCCCGATCTCCAACCCTATGCGTACCGACCTTTGTTGCTTTGGCGGGCCCGTTGGGGTGACCCACCGGTGG …

Acarospora stapfiana voucher Leavitt 18-362b BRY-C internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type180 records

Wild obs. + sensor59

Museum / vouchered121

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 38≤1 km 4≤10 km 2>10 km 4

48 georeferenced · 11 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤1 km 3≤10 km 7

14 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	33
St. Paul, US	23
Wuzhou, CN	12
Madison, US	11
Bronx, US	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Uppsala, SE	4
LDlocation not on record	3
Vancouver, CA	3
AUAlocation not on record	2
Bergen, NO	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
HAWlocation not on record	1
Boise, US	1
University of Stellenboschlocation not on record	1
Stockholm, SE	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Santa Barbara, US	1
Museum of the Rockieslocation not on record	1
Logan, US	1
Berlin, DE	1
US	1
Helsinki, FI	1
Chicago, US	1
Bozeman, US	1

25 institutions · 120 of 121 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Acarospora stapfiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)