Acanthostepheia malmgreni

(Goës, 1866) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Oedicerotidae/Acanthostepheia

At a glance

Occurrence records1 270

Data sources7

Biological traits4

DNA specimens10

eDNA detections8

Sources7 archives

Databases and archives Acanthostepheia malmgreni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility799 records↗

OBISOcean Biodiversity Information System471 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 270 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD10 specimens

01Narrative

Acanthostepheia malmgreni is een vlokreeftensoort uit de familie van de Oedicerotidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1866 door Goes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max1 330 m

Depth min5 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthostepheia malmgreni has left across the world's sequence archives.

At a glance

DNA specimens10

BINs3

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

1Amostly conserved

7Amostly conserved

40Tmostly conserved

85Tmostly conserved

103Cmostly conserved

106Tmostly conserved

124Amostly conserved

170Amostly conserved

172Cmostly conserved

196Gmostly conserved

202Cmostly conserved

205Cmostly conserved

217Tmostly conserved

229Gmostly conserved

253Gmostly conserved

262Amostly conserved

263Tmostly conserved

265Gvariable

266Cmostly conserved

268Amostly conserved

286Gmostly conserved

292Tmostly conserved

295Amostly conserved

301Amostly conserved

343Tmostly conserved

355Tmostly conserved

364Amostly conserved

373Amostly conserved

386Tmostly conserved

412Cmostly conserved

430Amostly conserved

436Gmostly conserved

466Gmostly conserved

493Amostly conserved

496Gmostly conserved

511Gmostly conserved

538Cmostly conserved

556Gmostly conserved

562Tmostly conserved

577Amostly conserved

580Gmostly conserved

581Cmostly conserved

601Cmostly conserved

619Amostly conserved

643Gmostly conserved

649Amostly conserved

AACCTTATATTTTATCTTAGGAGCATGAGCAAGAGTAGTTGGCACCTCCCTAAGTGTTATCATTCGCACAGAACTAGCTGCTCCTGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes3

BINs3

Most divergent pair5.8%

N.AmericaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 270 records

Wild obs. + sensor796

Museum / vouchered423

Other51

Range

Area of Occupancy AOO2 244 km²

Depth

0–200 m sunlit175

200–1000 m twilight244

1–4 km midnight36

>4 km abyssal1

median 231.4 m · max 4 500 m · 456 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 4≤1 km 225≤10 km 25>10 km 2

256 georeferenced · 540 without coordinates

Open the mapobservation + sensor796

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 3≤10 km 11>10 km 7

21 georeferenced · 402 without coordinates

Open the institutions mapphysical evidence423

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	150
Norwegian Institute of Marine Researchlocation not on record	48
Tromsø, NO	43
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	32
Stockholm, SE	27
Maurice Lamontagne Institutelocation not on record	23
ArcODlocation not on record	19
German Centre for Marine Biodiversity Researchlocation not on record	10
Instytut Oceanologii Polskiej Akademii Nauklocation not on record	8
University of Oslo (UiO)location not on record	5
NTNU-VMlocation not on record	4
CASlocation not on record	4
Toronto, CA	4
Helsinki, FI	2
Cambridge, US	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
University Museum of Bergen, Natural History Collectionslocation not on record	1
Washington, US	1
The Atlantic reference Centrelocation not on record	1
South Kensington, GB	1

20 institutions · 385 of 423 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Acanthostepheia malmgreni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-9.40 °C -16.9–-0.6

Seasonal swing summer↔winter17.3 °C

Max temp (day)-7.50 °C -15.4–0.3

Min temp (night)-11.1 °C -18.2–-2.50

Precipitation31.2 mm/mo 13.1–32.0

Air humidity70.3 % 68.6–77.5

Vapour deficit99.3 Pa 41.6–187

Cloud cover71.1 % 62.1–73.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthostepheia malmgreni

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type1 270 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 270 records