Acanthosoma haemorrhoidale

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Acanthosomatidae/Acanthosoma

At a glance

Occurrence records56 566

Data sources9

Biological traits2

DNA specimens34

eDNA detections106

Sources9 archives

Databases and archives Acanthosoma haemorrhoidale's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 566 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI106 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF56 566 records

Environmental DNA4 datasets · 9 countries106 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈866 Mbp

01Narrative

The hawthorn shield bug (Acanthosoma haemorrhoidale) is a common European shield bug. Its chief food is haws, the fruit of the hawthorn tree, but adults can overwinter on a diet of leaves, and individuals can be found on many potential food plants, including pedunculate oak, sessile oak and whitebeam. They may grow up to 17 mm long, and are camouflaged in shades of green and brown. Like many so-called "stink bugs", they may release unpleasant odours when disturbed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthosoma haemorrhoidale has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes2

eDNA detections106

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

316Amostly conserved

421Tmostly conserved

472Tmostly conserved

496Cmostly conserved

574Tmostly conserved

619Amostly conserved

AACAATATATTTTATATTCGGAATATGAGCAGGAATAGTAGGAACCGCTATAAGATGAATTATTCGCATTGAATTAAGTCAACCTAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes7

BINs2

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthosoma firmatumsame genus12.0%Lanopis rugosussame family13.1%Zicrona caeruleasame order14.6%Mormidea vayasame order15.0%Dysdercus cingulatussame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthosoma haemorrhoidale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈865 603 386 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthosoma haemorrhoidale0.87 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.2% BUSCO

08Occurrence & distribution

Record type56 566 records

Wild obs. + sensor55 632

Museum / vouchered872

Fossil4

Other58

Range

Area of Occupancy AOO84 668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 29 637≤1 km 6 393≤10 km 12 927>10 km 553

49 510 georeferenced · 6 122 without coordinates

Open the mapobservation + sensor55 632

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 215≤1 km 277≤10 km 316>10 km 4

812 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence872

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	235
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	81
SLU Artdatabankenlocation not on record	52
Provincia di Livornolocation not on record	18
Tartu, EE	17
Philadelphia, US	12
Kuopio, FI	12
Metsähallituslocation not on record	11
ZMAAlocation not on record	11
Helsinki, FI	10
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	10
neflocation not on record	8
CBDClocation not on record	8
Tallinn, EE	7
NEFlocation not on record	7
Jyväskylä, FI	5
South Kensington, GB	4
MZLUlocation not on record	4
Tromsø, NO	3
BioFokuslocation not on record	2
Natural History Museum, Londonlocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Uniwersytet Łódzkilocation not on record	2
ZSMlocation not on record	1
NMOKlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
UO-CeStuBiolocation not on record	1
Forssa, FI	1
DFlocation not on record	1
Winterthur, CH	1

30 institutions · 530 of 872 vouchered records shown · 342 without an institution code

09Environmental DNA106 detections

Where the DNA of Acanthosoma haemorrhoidale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found106

Studies independent surveys4

Countries9

Verifiable raw sequence linked69

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 106 detections have coordinates

Open the map9 countries0

organic farmUrban1. Forest & Woodland|1.4. Temperate ForestPfaffenbrundl, Bachlauf mit Kopfweiden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 4.20–18.1

Seasonal swing summer↔winter19.0 °C

Max temp (day)15.1 °C 5.50–22.5

Min temp (night)9.40 °C 1.50–13.4

Precipitation66.1 mm/mo 45.7–95.1

Air humidity62.4 % 56.5–67.3

Moisture balance-4.40 mm/mo -60.2–44.6

Vapour deficit519 Pa 275–873

Wind speed3.50 m/s 2.40–5.00

Cloud cover50.0 % 36.7–58.0

CHELSA 1981–2010, ~9 km grid, at location & month of 102 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthosoma haemorrhoidale

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type56 566 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type56 566 records