Acanthoscurria geniculata

(C.L.Koch, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Acanthoscurria

At a glance

Occurrence records70

Data sources10

Biological traits30

DNA specimens9

eDNA detections5

Sources10 archives

Databases and archives Acanthoscurria geniculata's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider Trait DBMasaryk University30 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources30 traits

Occurrence & distributionGBIF70 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD9 specimens

Genome at a glanceGoaT · NCBI≈7.2 Gbp

01Narrative

The Brazilian whiteknee tarantula (Acanthoscurria geniculata) is a species of tarantula from Brazil that is commonly kept as a pet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPaula dos et al. 2014Shao et al. 2023

Morphometry28

Abdomen length♀32.7·♂22.7 mm

Body length♀62.3·♂48.7 mm

Cephalothorax length♀29.6·♂26 mm

Cephalothorax width♀25·♂23 mm

Femur I length♀21·♂23.2 mm

Femur II length♀20·♂21 mm

Femur III length♀17.6·♂19 mm

Femur IV length♀21·♂22.4 mm

Leg I length♀72.9·♂86.6 mm

Leg II length♀68·♂78.5 mm

Leg III length♀76.7·♂75.2 mm

Leg IV length♀79.3·♂91.9 mm

Metatarsus I length♀14.7·♂20 mm

Metatarsus II length♀13.9·♂18.2 mm

Metatarsus III length♀15.9·♂20 mm

Metatarsus IV length♀21.7·♂27.6 mm

Patella I length♀12·♂12.1 mm

Patella II length♀11.1·♂11 mm

Patella III length♀10·♂10.2 mm

Patella IV length♀11·♂10.5 mm

Tarsus I length♀9·♂12.3 mm

Tarsus II length♀0.91·♂10.9 mm

Tarsus III length♀8.4·♂11 mm

Tarsus IV length♀9.6·♂12 mm

Tibia I length♀16.2·♂19 mm

Tibia II length♀13.9·♂17.4 mm

Tibia III length♀12.4·♂15 mm

Tibia IV length♀16·♂19.4 mm

Predation2

Hunting guild 2burrower

Web buildingyes

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthoscurria geniculata has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P612 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes2

BINs2

Most divergent pair0.16%

Where individuals differ — all 37 variable positions, in barcode order

27Amostly conserved

32Gmostly conserved

33Gmostly conserved

48Gmostly conserved

66Gmostly conserved

84Amostly conserved

120Amostly conserved

123Tmostly conserved

129Gmostly conserved

154Cmostly conserved

156Tmostly conserved

204Tmostly conserved

225Avariable

228Cmostly conserved

255Amostly conserved

276Gmostly conserved

279Avariable

282Amostly conserved

327Tmostly conserved

333Amostly conserved

357Amostly conserved

369Gmostly conserved

372Tmostly conserved

384Gmostly conserved

391Gmostly conserved

424Amostly conserved

432Amostly conserved

435Amostly conserved

447Amostly conserved

471Gmostly conserved

472Tvariable

477Cmostly conserved

486Cmostly conserved

504Amostly conserved

507Cmostly conserved

510Gvariable

543Cvariable

GCTATAAGAGTAATTATTCGTACTGAACTTGGGCAGGTGGGAAGATTGTTAGGAGATGATCATTTGTATAATGTTGTTGTTACAGCTCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Catumiri argentinensesame family12.9%Brachypelma smithisame family13.1%Brachypelma emiliasame family13.2%Tliltocatl verdezisame family13.4%Brachypelma klaasisame family13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthoscurria geniculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈7 178 402 394 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Acanthoscurria geniculata7.18 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type70 records

Wild obs. + sensor63

Museum / vouchered7

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 22≤1 km 17≤10 km 7>10 km 7

53 georeferenced · 10 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu Paraense Emílio Goeldilocation not on record	5
Buenos Aires, AR	1

2 institutions · 6 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Acanthoscurria geniculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 24.6–24.6

Seasonal swing summer↔winter2.20 °C

Max temp (day)28.8 °C

Min temp (night)21.8 °C

Precipitation316 mm/mo

Air humidity71.2 %

Moisture balance192 mm/mo

Vapour deficit886 Pa

Wind speed0.9 m/s

Cloud cover62.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)