Acanthopsyche atra

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Psychidae/Acanthopsyche

At a glance

Occurrence records1 848

Data sources8

Biological traits2

DNA specimens35

eDNA detections0

Sources8 archives

Databases and archives Acanthopsyche atra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 848 records↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 848 records

DNA & barcodingBOLD35 specimens

Genome at a glanceGoaT · NCBI≈880 Mbp

01Narrative

Acanthopsyche atra, the dusky sweep, is a moth of the family Psychidae. The habitat consists of heath and moorland.Hants Moths

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)herbivore

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthopsyche atra has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes15

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

28Gvariable

68Gmostly conserved

78Gmostly conserved

80Amostly conserved

82Cvariable

86Gmostly conserved

205Cmostly conserved

262Avariable

369Avariable

389Gmostly conserved

400Cvariable

428Tvariable

442Cmostly conserved

466Avariable

478Tvariable

517Tvariable

547Tmostly conserved

554Gmostly conserved

565Avariable

589Cmostly conserved

616Cmostly conserved

AACCCTTTACTTCATTTTAGGAATTTGGTCCGGACTAATCGGAACTTCCCTCAGATTCCTAATTCGAGCTGAACTTAGTACCCCAGATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BIN1

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachythelia villosellasame family7.8%Canephora hirsutasame family9.7%Hyaloscotes pithopoerasame family12.8%Acanthopsyche nigraplagasame genus13.1%Clania ignobilissame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND612SMT-NADH5

animal barcoderibosomalmitochondrialmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthopsyche atra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈879 661 470 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthopsyche atra0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.7% BUSCO

08Occurrence & distribution

Record type1 848 records

Wild obs. + sensor748

Museum / vouchered945

Other155

Origin

Native63

Range

Area of Occupancy AOO3 252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 134≤1 km 223≤10 km 371>10 km 6

734 georeferenced · 14 without coordinates

Open the mapobservation + sensor748

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 36≤1 km 277≤10 km 518>10 km 29

860 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence945

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	407
Provincia di Livornolocation not on record	149
Tartu, EE	48
Philadelphia, US	30
DanishLepidopterologicalSocietylocation not on record	29
ZMAAlocation not on record	26
Salzburg, AT	25
NHMOlocation not on record	25
SLU Artdatabankenlocation not on record	18
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	14
NMOKlocation not on record	13
Muzeum Górnośląskie w Bytomiulocation not on record	12
Bern, CH	4
Kuopio, FI	4
Helsinki, FI	4
NMBU:MINAlocation not on record	3
Research Collection of Kai Berggrenlocation not on record	3
Stockholm, SE	2
Natural History Museum Rotterdamlocation not on record	2
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
South Kensington, GB	1
Private Collection of Michael Weidlichlocation not on record	1

23 institutions · 822 of 945 vouchered records shown · 123 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthopsyche atra

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 848 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Record type1 848 records