Acanthopleura loochooana

(Broderip & G.B.Sowerby I, 1829) · species

image placeholder — illustration coming later

Animalia/Mollusca/Polyplacophora/Chitonida/Chitonidae/Acanthopleura

At a glance

Occurrence records630

Data sources6

Biological traits2

DNA specimens7

eDNA detections6

Sources6 archives

Databases and archives Acanthopleura loochooana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

OBISOcean Biodiversity Information System549 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS630 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Acanthopleura loochooana is een keverslakkensoort uit de familie van de Chitonidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1829 door Broderip & G.B. Sowerby I.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthopleura loochooana has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes2

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Diversity (π)9.0%

Haplotypes2

BINs2

Most divergent pair17.0%

Where individuals differ — all 120 variable positions, in barcode order

1Tvariable

4Cvariable

29Tvariable

34Avariable

37Gvariable

43Tvariable

46Tvariable

49Cvariable

50Cmostly conserved

52Avariable

55Tmostly conserved

58Avariable

73Gvariable

79Gmostly conserved

82Gvariable

85Cmostly conserved

88Amostly conserved

92Cmostly conserved

94Tmostly conserved

100Amostly conserved

103Cmostly conserved

109Gmostly conserved

110Tmostly conserved

127Tmostly conserved

130Amostly conserved

139Cmostly conserved

151Cmostly conserved

157Cmostly conserved

160Gmostly conserved

163Amostly conserved

166Amostly conserved

169Cvariable

178Cmostly conserved

184Amostly conserved

187Tmostly conserved

190Tvariable

193Tmostly conserved

196Amostly conserved

217Amostly conserved

223Amostly conserved

232Tmostly conserved

238Avariable

241Cmostly conserved

242Cmostly conserved

244Tmostly conserved

247Tmostly conserved

253Gmostly conserved

259Cmostly conserved

262Amostly conserved

263Cmostly conserved

265Tmostly conserved

266Tmostly conserved

268Avariable

271Tmostly conserved

274Avariable

277Cmostly conserved

290Tmostly conserved

293Avariable

294Gmostly conserved

298Cvariable

301Gmostly conserved

304Tmostly conserved

307Amostly conserved

318Tmostly conserved

322Tmostly conserved

325Cmostly conserved

328Avariable

334Amostly conserved

340Tmostly conserved

352Avariable

353Amostly conserved

361Tmostly conserved

364Tmostly conserved

370Avariable

373Amostly conserved

376Cmostly conserved

379Gmostly conserved

382Tmostly conserved

385Cmostly conserved

391Tmostly conserved

394Tmostly conserved

401Cmostly conserved

403Tmostly conserved

406Tmostly conserved

412Gmostly conserved

415Amostly conserved

418Cmostly conserved

421Cmostly conserved

433Amostly conserved

439Tmostly conserved

454Amostly conserved

457Tmostly conserved

458Amostly conserved

469Amostly conserved

472Gmostly conserved

485Tmostly conserved

490Amostly conserved

494Cmostly conserved

496Tmostly conserved

499Amostly conserved

526Amostly conserved

529Tmostly conserved

532Tmostly conserved

535Tmostly conserved

544Gmostly conserved

547Cmostly conserved

556Cmostly conserved

568Amostly conserved

581Cmostly conserved

583Tmostly conserved

592Gmostly conserved

604Amostly conserved

613Cvariable

616Cvariable

622Tvariable

625Tvariable

634Tvariable

637Avariable

641Cvariable

649Avariable

TACCCTTTATATTTTATTTGGAATTTGATCAGGATTGGTTGGTACTGCCCTAAGTTTATTAATTCGAGCTGAGTTAGGGCAGCCCGGAGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_068064 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX3ND3ND2COX1COX2ATP8ATP6ND5ND4ND4LCYTBND6ND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type630 records

Wild obs. + sensor612

Museum / vouchered14

Other4

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤100 m 14≤1 km 13≤10 km 537>10 km 15

579 georeferenced · 33 without coordinates

Open the mapobservation + sensor612

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Natural History Museum Rotterdamlocation not on record	2
BIKlocation not on record	1
CASlocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1

6 institutions · 9 of 14 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Acanthopleura loochooana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)