Acanthopleura gemmata

(Blainville, 1825) · species

image placeholder — illustration coming later

Animalia/Mollusca/Polyplacophora/Chitonida/Chitonidae/Acanthopleura

At a glance

Occurrence records1 947

Data sources11

Biological traits6

DNA specimens13

eDNA detections9

Sources11 archives

Databases and archives Acanthopleura gemmata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 393 records↗

OBISOcean Biodiversity Information System554 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 947 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT · NCBI≈720 Mbp

01Narrative

Acanthopleura gemmata, the jewelled chiton, is a species of chiton.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max2 m

Depth min0 m

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthopleura gemmata has left across the world's sequence archives.

At a glance

DNA specimens13

BINs4

Marker genes2

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 70% of positions are identical in every specimen.

Diversity (π)10.6%

Haplotypes2

BINs4

Most divergent pair0.92%

Where individuals differ — all 197 variable positions, in barcode order

2Tmostly conserved

3Gvariable

4Tmostly conserved

5Amostly conserved

7Amostly conserved

9Tmostly conserved

12Amostly conserved

13Tmostly conserved

14Tmostly conserved

15Tvariable

16Gmostly conserved

17Gmostly conserved

18Gvariable

19Amostly conserved

20Tmostly conserved

21Cvariable

23Gmostly conserved

25Tmostly conserved

26Cmostly conserved

27Amostly conserved

28Gmostly conserved

29Gmostly conserved

30Cvariable

31Tvariable

33Amostly conserved

35Tmostly conserved

36Amostly conserved

37Gmostly conserved

38Gmostly conserved

39Cmostly conserved

40Amostly conserved

42Tmostly conserved

43Gmostly conserved

44Cmostly conserved

45Tmostly conserved

46Cmostly conserved

47Tmostly conserved

48Tmostly conserved

49Amostly conserved

50Gmostly conserved

51Tmostly conserved

52Cmostly conserved

54Tmostly conserved

55Tmostly conserved

57Amostly conserved

58Amostly conserved

59Tmostly conserved

60Cmostly conserved

61Cmostly conserved

62Gmostly conserved

63Avariable

65Cmostly conserved

66Tmostly conserved

67Gmostly conserved

68Amostly conserved

69Gmostly conserved

70Cvariable

71Tmostly conserved

72Avariable

73Gmostly conserved

74Gmostly conserved

75Cvariable

77Amostly conserved

78Gmostly conserved

79Cmostly conserved

80Cmostly conserved

81Gvariable

83Gmostly conserved

84Amostly conserved

85Gmostly conserved

86Cmostly conserved

87Tmostly conserved

88Tmostly conserved

91Tmostly conserved

92Tmostly conserved

95Gmostly conserved

96Amostly conserved

99Tmostly conserved

105Avariable

108Avariable

114Tvariable

117Avariable

120Cvariable

123Tmostly conserved

126Amostly conserved

129Amostly conserved

132Cmostly conserved

141Gvariable

147Tmostly conserved

154Cmostly conserved

159Tmostly conserved

165Tvariable

177Amostly conserved

183Tmostly conserved

186Amostly conserved

192Gvariable

198Cmostly conserved

201Tvariable

207Gvariable

208Cmostly conserved

210Avariable

213Amostly conserved

219Tmostly conserved

222Tmostly conserved

225Amostly conserved

231Tvariable

234Cvariable

237Amostly conserved

238Cvariable

240Amostly conserved

246Tmostly conserved

249Amostly conserved

252Gvariable

255Tmostly conserved

259Cvariable

261Amostly conserved

262Tmostly conserved

264Avariable

270Tmostly conserved

276Avariable

+77 more variable positions not shown

TTGTATATTTTATTTGGGATCTGATCAGGCTTAGTAGGCACTGCTCTTAGTCTTTTAATCCGAGCTGAGCTAGGCCAGCCGGGAGCTTTA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Liolophura gaimardisame family14.2%Acanthopleura granulatasame genus14.8%Dinoplax gigassame order15.9%Chiton tuberculatussame family16.4%Cephalothrix hermaphroditicussame order17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthopleura gemmata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈719 716 592 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthopleura gemmata0.72 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 947 records

Wild obs. + sensor642

Museum / vouchered1 293

Other12

Range

Area of Occupancy AOO3 492 km²

Depth

0–200 m sunlit81

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.8 m · max 14 m · 81 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 272≤1 km 148≤10 km 34>10 km 39

493 georeferenced · 149 without coordinates

Open the mapobservation + sensor642

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 20≤1 km 343≤10 km 137>10 km 303

803 georeferenced · 490 without coordinates

Open the institutions mapphysical evidence1 293

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	113
Sydney, AU	106
Brussels, BE	99
Philadelphia, US	83
Western Australian Museumlocation not on record	82
RBINS-Scientific Heritagelocation not on record	71
Museums Victorialocation not on record	54
Cambridge, US	47
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	32
Museum and Art Gallery of the Northern Territorylocation not on record	23
Natural History Museum Rotterdamlocation not on record	16
Washington, US	14
Santa Barbara Museum of Natural Historylocation not on record	12
Paris, FR	7
Natick, US	7
University of the South Pacificlocation not on record	5
Cantablocation not on record	4
Toyohashi Museum Of Natural Historylocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	4
Denver, US	2
Stockholm, SE	1
National Museums of Kenyalocation not on record	1

22 institutions · 787 of 1 293 vouchered records shown · 9 without an institution code

09Environmental DNA9 detections

Where the DNA of Acanthopleura gemmata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthopleura gemmata

At a glance

Sources11 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 947 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 947 records