Acanthopagrus arabicus — The Life Data

Animalia/Chordata/Perciformes/Sparidae/Acanthopagrus

At a glance

Occurrence records21

Data sources6

Biological traits6

DNA specimens13

eDNA detections0

Sources6 archives

Databases and archives Acanthopagrus arabicus's data was compiled from.

GBIFGlobal Biodiversity Information Facility20 records↗

OBISOcean Biodiversity Information System1 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS21 records

DNA & barcodingBOLD13 specimens

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length34.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max50 m

Vulnerability32.09

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthopagrus arabicus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes3

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

97Amostly conserved

225Gmostly conserved

558Gmostly conserved

639Cmostly conserved

GGTGCTTGAGCTGGAATAGTAGGAACCGCCTTAAGCCTGCTCATTCGAGCCGAACTAAGCCAACCTGGTGCTCTCCTAGGAGACGACCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.31%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sparidentex jamalensissame family6.9%Sparidentex hastasame family7.4%Acanthopagrus sheimsame genus7.6%Acanthopagrus australissame genus7.7%Acanthopagrus butcherisame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P16SRAG1

animal barcoderibosomalmarker

08Occurrence & distribution

Record type21 records

Wild obs. + sensor11

Museum / vouchered10

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 6≤1 km 2>10 km 1

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.