Acanthonus armatus

Günther, 1878 · species

image placeholder — illustration coming later

Animalia/Chordata/Ophidiiformes/Ophidiidae/Acanthonus

At a glance

Occurrence records471

Data sources9

Biological traits7

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Acanthonus armatus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility225 records↗

OBISOcean Biodiversity Information System246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS471 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

The bony-eared assfish (Acanthonus armatus) is a bathypelagic species of cusk-eel found in tropical and sub-tropical oceans at depths of from 1171 to. It has been found as far north as Queen Charlotte Sound off British Columbia's coast. This species grows to a length of 37.5 cm SL. It is the only known member of its genus Acanthonus. The bony-eared assfish may have the smallest brain-to-body weight ratio of all vertebrates. Like many other creatures that dwell in the depths of the sea, assfish are soft and flabby with a light skeleton. This is likely to have resulted from a lack of food and the high pressures which accompany living at such a depth, making it difficult to generate muscle and bone.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length37.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max4 415 m

Depth min1 171 m

Vulnerability35.75

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthonus armatus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P672 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

2Cmostly conserved

38Gvariable

78Tmostly conserved

347Amostly conserved

515Gvariable

581Gmostly conserved

632Amostly conserved

TCGGCACCCTATATCTAGTATTTGGTGCTTGGGCCGGGATAGTCGGGACAGCCTTAAGCCTTCTTATTCGGGCAGAATTGAGCCAACCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes4

BIN1

Most divergent pair0.60%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xyelacyba myersisame family13.4%Pterocaesio marrisame order15.6%Pterocaesio tessellatasame order15.8%Cirripectes chelomatussame order16.0%Lutjanus lemniscatussame order16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type471 records

Wild obs. + sensor217

Museum / vouchered224

Other30

Origin

Native9

Range

Area of Occupancy AOO736 km²

Depth

0–200 m sunlit1

200–1000 m twilight1

1–4 km midnight130

>4 km abyssal0

median 2 539.2 m · max 3 470 m · 132 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 108≤1 km 3≤10 km 1>10 km 4

116 georeferenced · 101 without coordinates

Open the mapobservation + sensor217

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 2≤10 km 3

9 georeferenced · 215 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	63
Paris, FR	11
Texas Cooperative Wildlife Collectionlocation not on record	9
Copenhagen, DK	4
College Station, US	3
University of California San Diegolocation not on record	3
South Kensington, GB	2
Cambridge, US	1
FishBaselocation not on record	1
University of Texas Biodiversity Collections (UTBC)location not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Chicago, US	1
Washington, US	1

13 institutions · 101 of 224 vouchered records shown · 6 without an institution code

09Environmental DNA7 detections

Where the DNA of Acanthonus armatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 20.1–27.2

Seasonal swing summer↔winter5.30 °C

Max temp (day)26.5 °C 21.8–27.8

Min temp (night)25.4 °C 18.0–26.5

Precipitation95.6 mm/mo 31.4–252

Air humidity65.8 % 59.4–66.0

Vapour deficit1,182 Pa 970–1,270

Cloud cover33.9 % 26.1–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)