Acanthonotozoma cristatum

(Ross, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Acanthonotozomatidae/Acanthonotozoma

At a glance

Occurrence records465

Data sources6

Biological traits1

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Acanthonotozoma cristatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility251 records↗

OBISOcean Biodiversity Information System214 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS465 records

DNA & barcodingBOLD3 specimens

01Narrative

Acanthonotozoma cristatum is een vlokreeftensoort uit de familie van de Acanthonotozomatidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1835 door Ross.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthonotozoma cristatum has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

23Cvariable

102Tvariable

141Cvariable

363Avariable

378Tvariable

ACTCTTTATTTTGTGTTTGGGGCTTGAGCTAGGATAGTAGGTACTTCTTTAAGGGTCATTATTCGAACAGAGTTAGGAGCCCCCGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes3

BIN1

Most divergent pair0.61%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type465 records

Wild obs. + sensor273

Museum / vouchered166

Other26

Range

Area of Occupancy AOO736 km²

Depth

0–200 m sunlit52

200–1000 m twilight127

1–4 km midnight24

>4 km abyssal3

median 281.7 m · max 6 980 m · 206 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 12

14 georeferenced · 259 without coordinates

Open the mapobservation + sensor273

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence166

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ArcODlocation not on record	28
Norwegian Institute of Marine Researchlocation not on record	22
German Centre for Marine Biodiversity Researchlocation not on record	8
Stockholm, SE	6
Tromsø, NO	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
University of Oslo (UiO)location not on record	2
Bergen, NO	1
Maurice Lamontagne Institutelocation not on record	1
Toronto, CA	1

10 institutions · 78 of 166 vouchered records shown · 32 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)