Acantholyda hieroglyphica

(Christ, 1791) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pamphiliidae/Acantholyda

At a glance

Occurrence records1 460

Data sources6

Biological traits0

DNA specimens17

eDNA detections15

Sources6 archives

Databases and archives Acantholyda hieroglyphica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 460 records

Environmental DNA1 datasets · 4 countries15 detections

DNA & barcodingBOLD17 specimens

01Narrative

Larve Larven mit Gespinst Die Kiefernkultur-Gespinstblattwespe (Acantholyda hieroglyphica) ist eine Pflanzenwespe aus der Familie der Gespinstblattwespen (Pamphiliidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acantholyda hieroglyphica has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Tmostly conserved

23Amostly conserved

24Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

38Tmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

43Tmostly conserved

45Tmostly conserved

46Amostly conserved

47Tmostly conserved

48Cmostly conserved

49Tmostly conserved

51Tmostly conserved

54Gmostly conserved

56Amostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Tmostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

85Amostly conserved

86Gmostly conserved

87Gmostly conserved

90Cmostly conserved

91Tmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

223Avariable

250Cvariable

340Tvariable

343Cvariable

346Tmostly conserved

400Gmostly conserved

472Cmostly conserved

530Cvariable

616Cmostly conserved

628Gmostly conserved

TACTTTATATTTTATTTTTGGTATATGATCTGGAATATTAGGTTTATCTATAAGAATATTAATTCGATTAGAATTAGGAACTCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes3

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cephalcia arvensissame family10.0%Cephalcia lariciphilasame family10.0%Acantholyda posticalissame genus10.6%Cephalcia erythrogastersame family10.8%Cephalcia annulicornissame family11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 460 records

Wild obs. + sensor1 380

Museum / vouchered80

Origin

Native1

Range

Area of Occupancy AOO2 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 120≤1 km 33≤10 km 1 148>10 km 3

1 304 georeferenced · 76 without coordinates

Open the mapobservation + sensor1 380

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 22≤1 km 9≤10 km 17

48 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tilburg, NL	17
ZSMlocation not on record	6
SLU Artdatabankenlocation not on record	5
Oulu, FI	3
Helsinki, FI	3
Zürich, CH	3
BioFokuslocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Stockholm, SE	1
Nijmegen, NL	1
University of Oulu, Zoological Museumlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
MZLUlocation not on record	1
South Kensington, GB	1

15 institutions · 48 of 80 vouchered records shown · 32 without an institution code

09Environmental DNA15 detections

Where the DNA of Acantholyda hieroglyphica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 8.80–16.5

Seasonal swing summer↔winter19.3 °C

Max temp (day)17.1 °C 11.3–20.5

Min temp (night)8.50 °C 4.00–12.9

Precipitation77.1 mm/mo 52.7–270

Air humidity58.8 % 57.9–64.0

Moisture balance-30.4 mm/mo -52.9–218

Vapour deficit649 Pa 436–773

Wind speed3.50 m/s 2.40–4.90

Cloud cover38.8 % 35.1–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acantholyda hieroglyphica

At a glance

Sources6 archives

At a glance

Record type1 460 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 460 records