Acantholycosa norvegica

(Thorell, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Acantholycosa

At a glance

Occurrence records204

Data sources8

Biological traits9

DNA specimens11

eDNA detections4

Sources8 archives

Databases and archives Acantholycosa norvegica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

World Spider Trait DBMasaryk University9 traits · 18 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements18 literature sources9 traits

Occurrence & distributionGBIF204 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD11 specimens

01Narrative

Acantholycosa norvegica is a wolf spider species in the genus Acantholycosa with a Palearctic distribution.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 18 sources

LGBl 2015Entling et al. 2007Buchar & Růžička 2002SLU 2020Gajdoš et al. 2014Henriksen & Hilmo 2015Hyvärinen et al. 2019Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Finch 2004Liste France 2018Noflatscher 1994Řezáč et al. 2015Staręga et al. 2002Komposch & Steinberger 1999Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀8.25·♂6.5 mm

Predation1

Hunting guildground hunters

Ecology7

Legal protectionYes

Light0.875 mm

Light 2open

Moisture 10.625 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryVulnerable (3)

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acantholycosa norvegica has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

1Amostly conserved

73Gmostly conserved

97Avariable

100Cmostly conserved

124Amostly conserved

166Amostly conserved

184Gmostly conserved

214Gvariable

241Amostly conserved

268Avariable

295Amostly conserved

358Amostly conserved

364Tmostly conserved

367Tmostly conserved

442Tmostly conserved

478Tvariable

484Tmostly conserved

532Amostly conserved

550Amostly conserved

616Tmostly conserved

649Avariable

AACTTTATATTTAATATTTGGGGTTTGATCAGCTATAATAGGAACTGCTATAAGAGTATTAATTCGAATAGAGTTAGGAAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes4

BINs3

Most divergent pair2.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acantholycosa lignariasame genus1.7%Pardosa ferrugineasame family3.2%Pardosa adustellasame family3.2%Pardosa prativagasame family3.3%Pardosa dorsalissame family3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type204 records

Wild obs. + sensor75

Museum / vouchered126

Other3

Origin

Native4

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 48≤1 km 19≤10 km 7

74 georeferenced · 1 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 31≤1 km 10≤10 km 30>10 km 20

91 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ekaterinburg, RU	39
Helsinki, FI	31
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	20
SLU Artdatabankenlocation not on record	15
Bern, CH	6
Rovaniemi, FI	5
MZLUlocation not on record	3
NTNU-VMlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
NHMOlocation not on record	1
Frankfurt am Main	1

11 institutions · 125 of 126 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Acantholycosa norvegica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Dry heath

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.60 °C 7.60–10.4

Seasonal swing summer↔winter21.3 °C

Max temp (day)11.1 °C 10.1–12.5

Min temp (night)3.10 °C 2.10–5.80

Precipitation107 mm/mo 85.8–137

Air humidity61.6 % 60.1–63.6

Moisture balance8.60 mm/mo -18.8–38.0

Vapour deficit430 Pa 417–460

Wind speed4.20 m/s 3.90–5.30

Cloud cover51.0 % 49.1–60.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)