Acantholithodes hispidus

(Stimpson, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Hapalogastridae/Acantholithodes

At a glance

Occurrence records410

Data sources6

Biological traits5

DNA specimens9

eDNA detections11

Sources6 archives

Databases and archives Acantholithodes hispidus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility277 records↗

OBISOcean Biodiversity Information System133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS410 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD9 specimens

01Narrative

Acantholithodes hispidus is een tienpotigensoort uit de familie van de Hapalogastridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1860 door Stimpson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max150 m

Depth min0 m

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acantholithodes hispidus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

34Gmostly conserved

91Cvariable

97Cmostly conserved

292Amostly conserved

367Cvariable

386Cvariable

472Tmostly conserved

500Cvariable

526Cmostly conserved

628Gmostly conserved

AACACTATATTTTATTTTTGGAGCATGAGCTGGGATAGTTGGAACTTCCCTGAGTTTAATTATTCGAGCAGAATTAGGTCAACCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes5

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neolithodes grimaldiisame order11.6%Lopholithodes mandtiisame order11.7%Lithodes aequispinussame order12.0%Lithodes majasame order12.0%Lopholithodes foraminatussame order12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type410 records

Wild obs. + sensor309

Museum / vouchered96

Other5

Range

Area of Occupancy AOO924 km²

Depth

0–200 m sunlit53

200–1000 m twilight8

1–4 km midnight1

>4 km abyssal0

median 139.7 m · max 1 150 m · 62 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 99≤1 km 70≤10 km 9>10 km 23

201 georeferenced · 108 without coordinates

Open the mapobservation + sensor309

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 3≤10 km 5>10 km 5

13 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	26
CASlocation not on record	13
Edmonton, CA	11
Washington, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Cambridge, US	3
Santa Barbara Museum of Natural Historylocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
	1

10 institutions · 69 of 96 vouchered records shown · 3 without an institution code

09Environmental DNA11 detections

Where the DNA of Acantholithodes hispidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

urchin barrenrocky reefrock outcropsoft sediment

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 9.10–15.6

Seasonal swing summer↔winter13.0 °C

Max temp (day)14.2 °C 10.0–18.0

Min temp (night)8.80 °C 5.40–13.6

Precipitation115 mm/mo 56.9–277

Air humidity65.3 % 58.1–67.6

Vapour deficit422 Pa 374–740

Cloud cover39.5 % 39.0–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)