Acantholimon glumaceum

(Jaub. & Spach) Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Plumbaginaceae/Acantholimon

At a glance

Occurrence records24

Data sources6

Biological traits9

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Acantholimon glumaceum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionNPASS32 compounds

Occurrence & distributionGBIF24 records

DNA & barcodingNCBIsequences

01Narrative

الغملول القشري نوع نباتي يتبع جنس الغملول من الفصيلة الرصاصية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Flowering endSep

Flowering startJul

Life formsubshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Growth formshrub

Habitat GIFTmountains, stony places

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition32 compounds

Compounds documented for Acantholimon glumaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols7

Chalcones5

Flavanones2

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2S)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(S)-5-Hydroxy-7-Methoxy-8-Methyl-2-Phenylchroman-4-One	present	NPASS
1-(2-Hydroxy-4,6-dimethoxyphenyl)-3-phenyl-2-propen-1-one	present	NPASS
2',6'-Dihydroxy-3'-methyl-4'-methoxychalcone	present	NPASS
5,7,4'-Trihydroxy-3,8-dimethoxyflavone	present	NPASS
5,7-Dihydroxy-3-methoxy-6,8-dimethylflavone	present	NPASS
5,8-Dihydroxy-3,7-dimethoxyflavone	present	NPASS
6,8-Di-C-methylkaempferol 7-methyl ether	present	NPASS
BTMSZSUTMKSUKV-CMDGGOBGSA-N	present	NPASS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acantholimon glumaceum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSLC153857.1 ↗615 bp

ACGT

TCGAAACCTGCATAGCAGAGCAACATGCGAACTTGTCTTTTCAACCTTCCTTTCCGTGTGGCGGGTCAGACGACTCGTGCTTCCTCCGCC …

Acantholimon glumaceum gene for ITS1, 5.8S rRNA and ITS2, partial and complete sequence, specimen_voucher: W:2003-0005690

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor2

Museum / vouchered21

Cultivated / captive1

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 1≤1 km 2≤10 km 7

10 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence21

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	16
Podgorica, ME	1
GJOlocation not on record	1
Denver, US	1
BGBMlocation not on record	1
Wlocation not on record	1

6 institutions · 21 of 21 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)