Acanthodiaptomus denticornis

(Wierzejski, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Copepoda/Calanoida/Diaptomidae/Acanthodiaptomus

At a glance

Occurrence records2 504

Data sources6

Biological traits0

DNA specimens11

eDNA detections11

Sources6 archives

Databases and archives Acanthodiaptomus denticornis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 504 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 504 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT2n = 32

01Narrative

Acanthodiaptomus denticornis is een eenoogkreeftjessoort uit de familie van de Diaptomidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1887 door Wierzejski.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthodiaptomus denticornis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.13%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 4 variable positions, in barcode order

76Cmostly conserved

97Tmostly conserved

166Amostly conserved

460Cmostly conserved

GACATTGTATTTAATTGCTGGGGCTTGGTCTGGGATAGTTGGGACTGGTTTAAGAATAATCATTCGAATGGAGCTCGGGCAAGCGGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthodiaptomus pacificussame genus16.0%Skistodiaptomus reighardisame family17.3%Mastigodiaptomus hasame family17.5%Paracalanus parvussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Acanthodiaptomus denticornis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 504 records

Wild obs. + sensor937

Museum / vouchered1 566

Cultivated / captive1

Origin

Native10

Range

Area of Occupancy AOO1 984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 628≤1 km 7≤10 km 5

640 georeferenced · 297 without coordinates

Open the mapobservation + sensor937

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1 541≤1 km 10

1 551 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence1 566

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	1 552
Institute of Ecology of the Volga river basin of Russian Academy of Sciences \| IEVB RASlocation not on record	10
Victoria, CA	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2

4 institutions · 1 566 of 1 566 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Acanthodiaptomus denticornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.30 °C 6.30–7.90

Seasonal swing summer↔winter15.2 °C

Max temp (day)10.0 °C 10.0–11.1

Min temp (night)2.10 °C 2.10–3.70

Precipitation123 mm/mo 91.2–123

Air humidity64.2 % 63.8–64.3

Moisture balance47.0 mm/mo 39.9–47.9

Vapour deficit370 Pa 368–416

Wind speed4.90 m/s 2.00–4.90

Cloud cover41.7 % 41.7–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthodiaptomus denticornis

At a glance

Sources6 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 504 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 504 records