Acanthocyclus gayi

Lucas, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Belliidae/Acanthocyclus

At a glance

Occurrence records241

Data sources8

Biological traits0

DNA specimens5

eDNA detections4

Sources8 archives

Databases and archives Acanthocyclus gayi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility172 records↗

OBISOcean Biodiversity Information System69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS241 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Acanthocyclus gayi is een krabbensoort uit de familie van de Belliidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1844 door Lucas, in H. Milne Edwards & Lucas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocyclus gayi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

286Amostly conserved

616Cmostly conserved

649Gmostly conserved

AACTTTATACTTTATTTTTGGTGCTTGAGCTGGTATAGTTGGCACATCACTAAGATTAATTATTCGAGCAGAACTAGGTCAACCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes3

BIN1

Most divergent pair0.46%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthocyclus hasslerisame genus8.1%Acanthocyclus albatrossissame genus8.7%Hyas lyratussame order14.1%Menippe adinasame order14.3%Menippe mercenariasame order14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type241 records

Wild obs. + sensor188

Museum / vouchered53

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 185 without coordinates

Open the mapobservation + sensor188

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 14≤10 km 1>10 km 1

16 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	15
Stockholm, SE	13
Los Angeles, US	6
Cambridge, US	4
Zoologisches Museum Hamburglocation not on record	4
UCHILElocation not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
University of Oslo (UiO)location not on record	1
Bavarian State Collection of Zoologylocation not on record	1

9 institutions · 46 of 53 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Acanthocyclus gayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.1–14.9

Seasonal swing summer↔winter5.80 °C

Max temp (day)16.6 °C 15.4–17.9

Min temp (night)12.2 °C 11.6–12.9

Precipitation80.7 mm/mo 70.2–91.1

Air humidity62.0 % 61.0–63.1

Vapour deficit624 Pa 590–658

Cloud cover14.5 % 11.4–17.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)