Acanthoclinus fuscus

Jenyns, 1841 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Plesiopidae/Acanthoclinus

At a glance

Occurrence records674

Data sources8

Biological traits9

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Acanthoclinus fuscus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility529 records↗

OBISOcean Biodiversity Information System145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF · OBIS674 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

The olive rockfish, Acanthoclinus fuscus, is a longfin of the family Plesiopidae. Found only in New Zealand's intertidal zone and in rock pools at low tide, the fish grow to a length of up to 30 cm. They are permanent inhabitants of the intertidal zone, which demonstrate homing behaviour, and are found in pools among rocks or boulders. If the conditions in these pools become unsuitable they may leave the pools. Their diet consists mostly of invertebrates, mainly crustaceans and molluscs. They are able to breathe air. This species swims with a sinuous motion similar to an eel. The male guards the eggs. Olive rockfish are black with a distinctive white band on the head.http://www.marinelife.ac.nz/species/693

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology1

Body length30 cm

Life cycle & reproduction1

Max. longevity108 months

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max4 m

Depth min0 m

Vulnerability20

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthoclinus fuscus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTTTATCTAATCTTTGGTGCATGAGCTGGAATAGTGGGCACTGCTTTGAGCCTGCTAATCCGAGCCGAACTAAGCCAACCAGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lepidoperca filamentasame order15.5%Lepidoperca inornatasame order16.3%Plectroglyphidodon sagmariussame order16.3%Lepidoperca magnasame order16.4%Percichthys truchasame order16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type674 records

Wild obs. + sensor594

Museum / vouchered80

Origin

Native4

Range

Area of Occupancy AOO1 128 km²

Depth

0–200 m sunlit16

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 15 m · 16 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 269≤1 km 126≤10 km 25>10 km 6

426 georeferenced · 168 without coordinates

Open the mapobservation + sensor594

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 21≤10 km 3

24 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	23
Texas Cooperative Wildlife Collectionlocation not on record	3
Toronto, CA	2
Washington, US	2
Auckland, NZ	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Los Angeles, US	1
University of California San Diegolocation not on record	1
Frankfurt am Main	1

9 institutions · 36 of 80 vouchered records shown · 11 without an institution code

09Environmental DNA3 detections

Where the DNA of Acanthoclinus fuscus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.0–16.9

Seasonal swing summer↔winter7.60 °C

Max temp (day)18.2 °C 17.3–18.2

Min temp (night)15.2 °C 14.3–15.2

Precipitation95.9 mm/mo 95.9–100

Air humidity60.0 % 60.0–60.6

Vapour deficit766 Pa 722–766

Cloud cover35.9 % 35.3–35.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)