Acanthocercus annectens

(Blanford, 1870) · species

image placeholder — illustration coming later

Animalia/Chordata/Squamata/Agamidae/Acanthocercus

At a glance

Occurrence records49

Data sources8

Biological traits0

DNA specimens16

eDNA detections9

Sources8 archives

Databases and archives Acanthocercus annectens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · NCBI≈1.7 Gbp

01Narrative

Acanthocercus annectens est une espèce de sauriens de la famille des Agamidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocercus annectens has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes2

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

38Gmostly conserved

40Gmostly conserved

88Amostly conserved

91Amostly conserved

97Cmostly conserved

104Tmostly conserved

106Tmostly conserved

112Tmostly conserved

115Tmostly conserved

119Tmostly conserved

154Cmostly conserved

160Gmostly conserved

163Gmostly conserved

178Amostly conserved

184Tmostly conserved

187Amostly conserved

202Amostly conserved

211Tmostly conserved

214Gvariable

247Cmostly conserved

265Cmostly conserved

271Amostly conserved

274Cmostly conserved

293Gmostly conserved

313Amostly conserved

316Amostly conserved

319Cmostly conserved

322Amostly conserved

337Tmostly conserved

340Cmostly conserved

349Tmostly conserved

355Tmostly conserved

365Tmostly conserved

370Gmostly conserved

382Tmostly conserved

394Tmostly conserved

406Gmostly conserved

418Amostly conserved

424Cmostly conserved

427Gmostly conserved

430Gmostly conserved

442Tmostly conserved

457Cmostly conserved

460Cmostly conserved

480Amostly conserved

481Tmostly conserved

493Gmostly conserved

496Tmostly conserved

511Cmostly conserved

518Tmostly conserved

520Amostly conserved

529Tmostly conserved

532Amostly conserved

539Tmostly conserved

562Amostly conserved

565Tmostly conserved

571Cmostly conserved

578Tmostly conserved

595Cmostly conserved

598Cmostly conserved

610Tmostly conserved

613Tmostly conserved

622Amostly conserved

625Cmostly conserved

637Cmostly conserved

AACACTATATTTCCTATTCGGCACAATAGCCGGACTGGTGGGTTCCACAGTTAGCCTAATAATCCGAATACAACTAATTCAACCCGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes3

BINs2

Most divergent pair0.76%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudotrapelus aqabensissame family16.9%Pseudotrapelus sinaitussame family17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Acanthocercus annectens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 736 362 833 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Acanthocercus annectens1.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type49 records

Wild obs. + sensor3

Museum / vouchered46

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	28
CASlocation not on record	17
Paris, FR	1

3 institutions · 46 of 46 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Acanthocercus annectens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.5 °C 28.2–28.5

Seasonal swing summer↔winter11.8 °C

Max temp (day)33.8 °C 33.4–33.8

Min temp (night)23.6 °C 23.1–23.6

Precipitation18.8 mm/mo 18.8–19.4

Air humidity56.9 % 55.9–56.9

Moisture balance-140 mm/mo -143–-140

Vapour deficit1,795 Pa 1,773–1,795

Wind speed3.60 m/s 3.60–3.70

Cloud cover13.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)