Acanthocepola krusensternii

(Temminck & Schlegel, 1845) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cepolidae/Acanthocepola

At a glance

Occurrence records162

Data sources7

Biological traits7

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Acanthocepola krusensternii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

OBISOcean Biodiversity Information System93 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS162 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD4 specimens

01Narrative

Acanthocepola krusensternii is een straalvinnige vissensoort uit de familie van lintvissen (Cepolidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1845 door Temminck & Schlegel.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length40 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max50 m

Depth min3 m

Vulnerability30

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocepola krusensternii has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 551 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

537Cmostly conserved

GTGATAATCACTCGCTGATTTTTTTCGACTAATCACAAAGATATCGGCACACTATACTTAGTGTTTGGCGCCTGGGCCGGCATAGTCGGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_034333 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type162 records

Wild obs. + sensor6

Museum / vouchered155

Other1

Range

Area of Occupancy AOO264 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 39.1 m · max 60 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 5 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 1≤1 km 24≤10 km 2>10 km 17

44 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence155

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	30
Natick, US	13
Washington, US	6
CASlocation not on record	4
Stockholm, SE	2
National Marine Biodiversity Institute of Korealocation not on record	2
Ann Arbor, US	2
Chicago, US	2
Cambridge, US	1
Paris, FR	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Yokosuka City Museumlocation not on record	1

12 institutions · 65 of 155 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Acanthocepola krusensternii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)