Acanthocephalus anguillae

Animalia/Acanthocephala/Palaeacanthocephala/Echinorhynchida/Echinorhynchidae/Acanthocephalus

At a glance

Occurrence records67

Data sources8

Biological traits2

DNA specimens18

eDNA detections27

Sources8 archives

Databases and archives Acanthocephalus anguillae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility66 records↗

OBISOcean Biodiversity Information System1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS67 records

Environmental DNA1 datasets · 0 countries27 detections

DNA & barcodingBOLD18 specimens

01Narrative

Acanthocephalus anguillae ist eine Art der Kratzwürmer (Acanthocephala), die als Darmparasit vor allem in Süßwasserfischen vorkommt und bei diesen eine Acanthocephalose auslöst.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonehost

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocephalus anguillae has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes3

eDNA detections27

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P603 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.95%

Haplotypes2

BIN1

Most divergent pair0.33%

Where individuals differ — all 15 variable positions, in barcode order

109Cmostly conserved

127Tmostly conserved

196Gmostly conserved

197Tmostly conserved

235Gvariable

242Cmostly conserved

274Gmostly conserved

289Gmostly conserved

290Gmostly conserved

301Gmostly conserved

319Tvariable

340Cmostly conserved

413Cmostly conserved

490Gmostly conserved

581Tmostly conserved

GTTAATGTACATAGTGTTGGGGTTTTGAGGTGGTTTGGTCGGGGTTTCTTTGAGCTTAATTTTGCGCTTAGAGCTGGGTGCTAGCGGAAC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PITS118S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type67 records

Museum / vouchered65

Other2

Range

Area of Occupancy AOO92 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 26≤10 km 23>10 km 5

54 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence65

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	54
MZLUlocation not on record	3
Washington, US	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1

4 institutions · 60 of 65 vouchered records shown · 5 without an institution code

09Environmental DNA27 detections

Where the DNA of Acanthocephalus anguillae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.