Acanthocephala terminalis

(Dallas, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Coreidae/Acanthocephala

At a glance

Occurrence records28 140

Data sources6

Biological traits0

DNA specimens8

eDNA detections1

Sources6 archives

Databases and archives Acanthocephala terminalis's data was compiled from.

GBIFGlobal Biodiversity Information Facility28 140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF28 140 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthocephala terminalis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.95%

Haplotypes2

BIN1

Most divergent pair0.93%

Where individuals differ — all 14 variable positions, in barcode order

74Cmostly conserved

88Gmostly conserved

98Gmostly conserved

100Gmostly conserved

115Tvariable

124Cmostly conserved

271Tmostly conserved

301Cmostly conserved

304Tmostly conserved

334Tmostly conserved

340Cmostly conserved

343Avariable

346Cmostly conserved

571Tmostly conserved

AACACTTTATTTTATTTTCGGAATATGATCTGGAATAGTAGGCTCTTCAATAAGATGAATTATCCGAGTAGAACTGGGTCAACCTGGGCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dysdercus cingulatussame order16.2%Oncocephalus breviscutumsame order16.6%Leptoglossus phyllopussame family17.0%Ischnodemus falicussame order17.3%Dysdercus obscuratussame order17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type28 140 records

Wild obs. + sensor27 875

Museum / vouchered265

Range

Area of Occupancy AOO64 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 15 735≤1 km 3 856≤10 km 1 405>10 km 2 508

23 504 georeferenced · 4 371 without coordinates

Open the mapobservation + sensor27 875

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 4≤1 km 46≤10 km 107>10 km 12

169 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence265

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	150
Wuzhou, CN	39
Denver, US	19
Sam Noble Oklahoma Museum of Natural Historylocation not on record	14
Cornell University Insect Collectionlocation not on record	9
University of Guelphlocation not on record	9
University Park, US	5
North Carolina State University Insect Museumlocation not on record	5
Montgomery, US	4
Natural History Museum of Utahlocation not on record	4
OSUClocation not on record	2
Saint John, CA	1
East Lansing, US	1
Albuquerque, US	1
CUlocation not on record	1

15 institutions · 264 of 265 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Acanthocephala terminalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthocephala terminalis

At a glance

Sources6 archives

At a glance

Record type28 140 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type28 140 records