Acanthephyra curtirostris

Wood-Mason & Alcock, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Acanthephyridae/Acanthephyra

At a glance

Occurrence records758

Data sources8

Biological traits4

DNA specimens14

eDNA detections20

Sources8 archives

Databases and archives Acanthephyra curtirostris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility404 records↗

OBISOcean Biodiversity Information System354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS758 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD14 specimens

01Narrative

Acanthephyra curtirostris is een garnalensoort uit de familie van de Acanthephyridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1891 door Wood-Mason & Alcock.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits2

Depth max5 900 m

Depth min300 m

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthephyra curtirostris has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections20

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 8 variable positions, in barcode order

185Gmostly conserved

347Amostly conserved

389Gmostly conserved

479Cmostly conserved

497Tmostly conserved

536Amostly conserved

602Cmostly conserved

656Amostly conserved

GGACATTATATTTCATCTTTGGGGCCTGGGCTGGGATAGTAGGCACTGCCCTTAGTCTTTTAATTCGAGCTGAGCTTGGTCAACCAGGAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthephyra stylorostratissame genus9.8%Acanthephyra sanguineasame genus14.8%Acanthephyra acutifronssame genus15.2%Heterogenys microphthalmasame family15.4%Acanthephyra acanthitelsonissame genus15.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type758 records

Wild obs. + sensor126

Museum / vouchered618

Cultivated / captive3

Other11

Origin

Native42

Range

Area of Occupancy AOO1 768 km²

Depth

0–200 m sunlit4

200–1000 m twilight86

1–4 km midnight221

>4 km abyssal13

median 1 609.3 m · max 5 330 m · 324 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced · 120 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 8≤1 km 2≤10 km 52>10 km 267

329 georeferenced · 289 without coordinates

Open the institutions mapphysical evidence618

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	155
Washington, US	93
Texas Cooperative Wildlife Collectionlocation not on record	42
Cambridge, US	12
Victoria, CA	9
	8
Frankfurt am Main	8
Xlocation not on record	4
New Haven, US	4
Paris, FR	4
CASlocation not on record	4
Sydney, AU	3
South Kensington, GB	3
UM-RSMASlocation not on record	3
SCSDlocation not on record	2
University of California San Diegolocation not on record	2
IEOlocation not on record	1
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1

19 institutions · 359 of 618 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Acanthephyra curtirostris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 11.8–19.9

Seasonal swing summer↔winter7.90 °C

Max temp (day)12.8 °C 12.7–20.9

Min temp (night)11.2 °C 11.1–19.1

Precipitation188 mm/mo 78.0–213

Air humidity63.4 % 58.5–63.6

Vapour deficit508 Pa 502–980

Cloud cover68.4 % 33.8–69.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)