Acanthepeira stellata

(Walckenaer, 1805) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Acanthepeira

At a glance

Occurrence records1 217

Data sources9

Biological traits2

DNA specimens33

eDNA detections32

Sources9 archives

Databases and archives Acanthepeira stellata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 217 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

World Spider Trait DBMasaryk University2 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources2 traits

Occurrence & distributionGBIF1 217 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD33 specimens

01Narrative

Acanthepeira stellata, known generally as the starbellied orbweaver or starbellied spider, is a species of orb weaver in the spider family Araneidae. It is found in a range from Canada to Mexico. It is most commonly found along the Eastern and Western coastline of North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPacheco Flores et al. 2013Pekár et al. 2012a

Predation2

Prey OrderColeoptera

Prey diversity3.51 mm

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthepeira stellata has left across the world's sequence archives.

At a glance

DNA specimens33

BINs2

Marker genes2

eDNA detections32

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

31Tvariable

52Amostly conserved

67Tmostly conserved

100Tmostly conserved

106Tvariable

109Gmostly conserved

127Cmostly conserved

163Amostly conserved

181Gmostly conserved

197Cmostly conserved

202Amostly conserved

217Amostly conserved

223Gmostly conserved

235Tmostly conserved

241Gmostly conserved

271Cvariable

284Tvariable

286Amostly conserved

295Cvariable

328Cmostly conserved

340Tmostly conserved

361Amostly conserved

401Tmostly conserved

433Gmostly conserved

469Gmostly conserved

478Amostly conserved

496Tmostly conserved

517Tvariable

518Cmostly conserved

541Amostly conserved

542Tmostly conserved

556Tmostly conserved

571Tmostly conserved

574Amostly conserved

616Cmostly conserved

625Gmostly conserved

631Avariable

634Tmostly conserved

CTCATTATATTTAATTTTTGGAGCTTGGGCTGCCATAGTAGGAACAGCAATAAGAGTTTTAATTCGTATTGAATTAGGTCAATCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes8

BINs2

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acanthepeira venustasame genus8.2%Larinioides cornutussame family12.0%Bijoaraneus legonensissame family12.6%Neoscona blondelisame family12.7%Micrathena forcipatasame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type1 217 records

Wild obs. + sensor1 033

Museum / vouchered184

Range

Area of Occupancy AOO3 920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 498≤1 km 149≤10 km 42>10 km 149

838 georeferenced · 195 without coordinates

Open the mapobservation + sensor1 033

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 5≤1 km 13≤10 km 39>10 km 9

66 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence184

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	36
Ohio State University Acarology Laboratorylocation not on record	26
Cambridge, US	17
Denver, US	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
Sam Noble Oklahoma Museum of Natural Historylocation not on record	10
Chicago, US	10
Biodiversity Institute of Ontariolocation not on record	6
Royal Ontario Museumlocation not on record	4
Chicago, US	3
Cincinnati, US	3
Frankfurt am Main	3
WIlocation not on record	2
US	2
EL PASO, US	1
Albuquerque, US	1

16 institutions · 153 of 184 vouchered records shown · 31 without an institution code

09Environmental DNA32 detections

Where the DNA of Acanthepeira stellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

GrasslandMixed habitatWetlandBeachForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 13.0–20.7

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.9 °C 18.7–25.7

Min temp (night)13.6 °C 7.80–17.7

Precipitation84.7 mm/mo 77.4–97.6

Air humidity57.5 % 55.1–61.3

Moisture balance-48.2 mm/mo -65.5–0.9

Vapour deficit855 Pa 660–1,039

Wind speed3.50 m/s 2.80–4.10

Cloud cover42.5 % 38.4–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acanthepeira stellata

At a glance

Sources9 archives

Predation2

At a glance

Record type1 217 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 217 records