Acanthemblemaria balanorum

Brock, 1940 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Chaenopsidae/Acanthemblemaria

At a glance

Occurrence records81

Data sources10

Biological traits6

DNA specimens5

eDNA detections1

Sources10 archives

Databases and archives Acanthemblemaria balanorum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

OBISOcean Biodiversity Information System27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS81 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

The clubhead blenny (Acanthemblemaria balanorum) or clubhead barnacle blenny, is native to the eastern Pacific Ocean, where it occurs from the Gulf of California along the coast of Mexico south to Colombia and Ecuador.Béarez, P., Bujard, J. T., & Campoverde, R. (2007). Description of four small reef fishes from Ecuador: Oxycirrhites typus (Cirrhitidae), Acanthemblemaria balanorum (Chaenopsidae), Arcos decoris (Gobiesocidae) and Lythrypnus dalli (Gobiidae). Cybium 31(4), 477-79. This fish lives in rocky reef habitat in tropical marine waters no deeper than 5 m. It inhabits empty barnacle shells, in particular those of Megabalanus tintinnabulum.Lindquist, D. G. (1985). Depth zonation, micro habitat, and morphology of three species of Acanthemblemaria (Pisces: Blennioidea) in the Gulf of California, Mexico. Marine Ecology 6(4), 329-44. The female lays eggs inside the shell and the male guards them. This fish feeds primarily on zooplankton.Froese, R. and D. Pauly, Editors. Acanthemblemaria balanorum. 2015. FishBase.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length5.19 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max5 m

Depth min1 m

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthemblemaria balanorum has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P693 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes2

BINs2

Most divergent pair1.0%

Where individuals differ — all 30 variable positions, in barcode order

1Cmostly conserved

5Avariable

12Avariable

15Cvariable

18Cvariable

64Amostly conserved

65Cmostly conserved

66Tmostly conserved

67Gmostly conserved

68Cmostly conserved

69Amostly conserved

70Tmostly conserved

72Amostly conserved

74Gmostly conserved

75Tmostly conserved

76Cmostly conserved

77Tmostly conserved

90Tmostly conserved

117Cmostly conserved

120Cmostly conserved

219Amostly conserved

226Tmostly conserved

255Tmostly conserved

324Gmostly conserved

367Tmostly conserved

520Tmostly conserved

684Cmostly conserved

687Cmostly conserved

690Cvariable

691Avariable

CCCCACCACAAAGACATCGGCACCCTATATTTAATTTTTGGTGCCTGAGCCGGAATAGTAGGGACTGCATTAAGTCTGCTCATTCGAGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paretroplus nourissatisame order17.5%Polysteganus undulosussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~1.47 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.47 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type81 records

Wild obs. + sensor23

Museum / vouchered58

Range

Area of Occupancy AOO168 km²

Depth

0–200 m sunlit12

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15.8 m · max 17.5 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1≤10 km 3

5 georeferenced · 18 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 8≤10 km 7

15 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of California San Diegolocation not on record	17
Vancouver, CA	5
CASlocation not on record	3
Morelia, MX	3
Paris, FR	2
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	2
New Haven, US	1
FishBaselocation not on record	1
Washington, US	1
Facultad de Ciencias Marinas, Universidad Autónoma de Baja Californialocation not on record	1

10 institutions · 36 of 58 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Acanthemblemaria balanorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)