Acanthaphritis barbata

(Okamura & Kishida, 1963) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Percophidae/Acanthaphritis

At a glance

Occurrence records111

Data sources7

Biological traits4

DNA specimens5

eDNA detections4

Sources7 archives

Databases and archives Acanthaphritis barbata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

OBISOcean Biodiversity Information System53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS111 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Acanthaphritis barbata is een straalvinnige vissensoort uit de familie van baarszalmen (Percophidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1963 door Okamura & Kishida.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acanthaphritis barbata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BINs2

Most divergent pair3.4%

Where individuals differ — all 22 variable positions, in barcode order

55Amostly conserved

76Cmostly conserved

79Gmostly conserved

169Cmostly conserved

175Tmostly conserved

203Tmostly conserved

268Tmostly conserved

280Cmostly conserved

283Tmostly conserved

289Gmostly conserved

385Gmostly conserved

400Gmostly conserved

427Gmostly conserved

448Tmostly conserved

490Gmostly conserved

505Tmostly conserved

514Tmostly conserved

565Tmostly conserved

589Gmostly conserved

637Cmostly conserved

640Amostly conserved

646Amostly conserved

CCTGTATATAGTATTTGGAGCCTGAGCAGGCATAGTAGGCACAGCTTTAAGCCTACTTATCCGAGCCGAGCTGAGCCAGCCAGGAGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lethrinus miniatussame order17.0%Prosopium williamsonisame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type111 records

Wild obs. + sensor20

Museum / vouchered81

Other10

Range

Area of Occupancy AOO172 km²

Depth

0–200 m sunlit18

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 104 m · max 413 m · 23 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 12

12 georeferenced · 8 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 6≤1 km 26≤10 km 8

40 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	14
Museums Victorialocation not on record	5
Kagoshima University Museumlocation not on record	5
Museum and Art Gallery of the Northern Territorylocation not on record	4
Sydney, AU	4
Natick, US	3
Paris, FR	2
CSIRO, Australian National Fish Collectionlocation not on record	1

8 institutions · 38 of 81 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Acanthaphritis barbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 21.4–21.4

Seasonal swing summer↔winter5.50 °C

Max temp (day)22.1 °C

Min temp (night)20.7 °C

Precipitation92.2 mm/mo

Air humidity55.0 %

Vapour deficit1,142 Pa

Cloud cover33.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)