Acamptopoeum prinii

(Holmberg, 1884) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Acamptopoeum

At a glance

Occurrence records381

Data sources5

Biological traits1

DNA specimens5

eDNA detections0

Sources5 archives

Databases and archives Acamptopoeum prinii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility381 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF381 records

DNA & barcodingBOLD5 specimens

01Narrative

Acamptopoeum prinii is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1884 door Holmberg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2 mm

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acamptopoeum prinii has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 22 variable positions, in barcode order

34Avariable

40Tmostly conserved

46Tmostly conserved

58Cmostly conserved

100Cmostly conserved

106Cmostly conserved

127Tmostly conserved

157Cmostly conserved

163Amostly conserved

190Amostly conserved

197Tmostly conserved

223Cmostly conserved

235Cmostly conserved

271Cmostly conserved

283Cmostly conserved

287Cmostly conserved

367Cvariable

370Cmostly conserved

505Tmostly conserved

548Cvariable

616Tvariable

619Cvariable

TATATTATACTTTATATTTGCAATATGAGCTGGAATAATTGGATCTTCAATAAGATACATTATTCGTATTGAATTAAGATCTCCCGGAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acamptopoeum submetallicumsame genus12.3%Panurginus occidentalissame family12.8%Panurginus beardsleyisame family13.1%Panurginus ineptussame family14.4%Sarocolletes rufipennissame order15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type381 records

Wild obs. + sensor8

Museum / vouchered361

Other12

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 3≤10 km 1>10 km 2

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 15≤10 km 52

67 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence361

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	269
	86
Beltsville, US	3
PUC-RSlocation not on record	2
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	1

5 institutions · 361 of 361 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)