Acalyptris minimella

(Rebel, 1926) van Nieukerken, 1986 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nepticulidae/Acalyptris

At a glance

Occurrence records33

Data sources8

Biological traits0

DNA specimens8

eDNA detections7

Sources8 archives

Databases and archives Acalyptris minimella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 6 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acalyptris minimella is a moth of the family Nepticulidae. It is widespread and common in the western Mediterranean region, usually not far from the sea. It has been recorded from Portugal, Spain, France, Italy, Croatia, Ibiza, Mallorca, Corsica, Sardinia and Sicily. It is also present in North Africa, where it has been recorded from Morocco, Algeria and Tunisia. The wingspan is 4.1-5.8 mm. There are two or more generations per year. The larvae feed on Pistacia lentiscus and Pistacia terebinthus. They mine the leaves of their host plant. The mine consists of an extremely narrow gallery, filled with frass, running a rather straight course, often following the margin of the leaflet or the midrib. The thin part is more than half the total length of the mine. Later, the mine widens gradually and becomes more contorted, often following a zigzag course. The exit hole is located on the leaf upperside.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalyptris minimella has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections7

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P665 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)4.0%

Haplotypes0

BIN1

Where individuals differ — all 85 variable positions, in barcode order

4Amostly conserved

5Amostly conserved

6Cmostly conserved

7Tmostly conserved

9Tmostly conserved

10Amostly conserved

12Amostly conserved

14Tmostly conserved

16Tmostly conserved

17Amostly conserved

19Amostly conserved

20Tmostly conserved

21Tmostly conserved

22Tmostly conserved

23Gmostly conserved

24Gmostly conserved

25Amostly conserved

26Amostly conserved

27Tmostly conserved

28Tmostly conserved

30Gmostly conserved

32Tmostly conserved

33Cmostly conserved

35Gmostly conserved

36Gmostly conserved

37Avariable

38Amostly conserved

41Tmostly conserved

42Tmostly conserved

44Gmostly conserved

45Gmostly conserved

46Amostly conserved

47Amostly conserved

51Cmostly conserved

52Tmostly conserved

53Tmostly conserved

54Tmostly conserved

56Amostly conserved

57Gmostly conserved

59Tmostly conserved

62Cmostly conserved

64Amostly conserved

65Amostly conserved

66Tmostly conserved

67Tmostly conserved

68Cmostly conserved

69Gmostly conserved

72Cmostly conserved

74Gmostly conserved

75Amostly conserved

77Tmostly conserved

78Tmostly conserved

80Gmostly conserved

81Gmostly conserved

82Avariable

83Amostly conserved

84Amostly conserved

85Tmostly conserved

86Cmostly conserved

87Cmostly conserved

89Gmostly conserved

90Gmostly conserved

91Amostly conserved

93Amostly conserved

94Tmostly conserved

95Tmostly conserved

97Amostly conserved

98Amostly conserved

99Tmostly conserved

100Tmostly conserved

102Gmostly conserved

103Amostly conserved

200Tmostly conserved

238Tvariable

286Amostly conserved

293Gmostly conserved

493Cvariable

547Avariable

550Amostly conserved

568Amostly conserved

619Cvariable

631Avariable

652Amostly conserved

661Cmostly conserved

665Nhighly variable

AACAACTTTATATTTTATATTTGGAATTTGATCAGGAATATTAGGAACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAAATCCAGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acalyptris pistaciaesame genus5.5%Acalyptris platanisame genus6.3%Acalyptris loranthellasame genus7.9%Ectoedemia platanellasame family8.7%Gnophos wanensissame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PEF1-alpha

animal barcodemarker

08Occurrence & distribution

Record type33 records

Wild obs. + sensor29

Museum / vouchered4

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 7≤1 km 19≤10 km 1

27 georeferenced · 2 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA7 detections

Where the DNA of Acalyptris minimella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map6 countries0

limestone matorral and forestPinus halepensis forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 11.1–23.4

Seasonal swing summer↔winter16.0 °C

Max temp (day)24.1 °C 14.0–27.2

Min temp (night)11.7 °C 7.80–19.2

Precipitation16.9 mm/mo 9.20–115

Air humidity58.5 % 52.8–63.1

Moisture balance-131 mm/mo -169–54.6

Vapour deficit961 Pa 535–1,214

Wind speed3.10 m/s 2.40–4.70

Cloud cover29.8 % 19.2–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)