Acalles misellus

Bohem., 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Acalles

At a glance

Occurrence records1 163

Data sources4

Biological traits1

DNA specimens15

eDNA detections15

Sources4 archives

Databases and archives Acalles misellus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 163 records

Environmental DNA1 datasets · 4 countries15 detections

DNA & barcodingBOLD15 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)xylophagous

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acalles misellus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections15

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

85Tmostly conserved

100Gmostly conserved

160Amostly conserved

208Gmostly conserved

215Gmostly conserved

241Amostly conserved

268Amostly conserved

271Amostly conserved

316Amostly conserved

319Gmostly conserved

361Cmostly conserved

364Tmostly conserved

424Amostly conserved

478Amostly conserved

619Amostly conserved

622Amostly conserved

AACCCTCTACTTTATTTTTGGGGCATGATCAGGAATACTAGGAACCTCATTAAGAATACTAATTCGAACTGAACTTTCCAGTCCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes6

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acalles echinatussame genus7.0%Acalles camelussame genus14.1%Acalles alcarazensissame genus14.5%Acalles sardiniaensissame genus14.7%Acalles fallaxsame genus14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 163 records

Wild obs. + sensor980

Museum / vouchered117

Fossil48

Other18

Range

Area of Occupancy AOO2 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 496≤1 km 160≤10 km 260>10 km 1

917 georeferenced · 63 without coordinates

Open the mapobservation + sensor980

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 35≤1 km 39≤10 km 26

100 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	72
Trondheim, NO	9
Natural History Museum Rotterdamlocation not on record	3
CBDClocation not on record	2
BioFokuslocation not on record	2
MZLUlocation not on record	2
SGAV-and-NHMDlocation not on record	1
NCMGlocation not on record	1
neflocation not on record	1

9 institutions · 93 of 117 vouchered records shown · 24 without an institution code

09Environmental DNA15 detections

Where the DNA of Acalles misellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 9.60–21.6

Seasonal swing summer↔winter14.2 °C

Max temp (day)17.4 °C 13.7–26.0

Min temp (night)9.90 °C 3.80–17.8

Precipitation65.5 mm/mo 37.4–120

Air humidity60.8 % 58.5–63.5

Moisture balance-56.3 mm/mo -118–43.6

Vapour deficit604 Pa 471–1,079

Wind speed3.10 m/s 1.70–4.10

Cloud cover37.0 % 32.8–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acalles misellus

At a glance

Sources4 archives

Diet & foraging1

At a glance

Record type1 163 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 163 records