Acaenacis lausus

(Walker, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pteromalidae/Acaenacis

At a glance

Occurrence records8

Data sources6

Biological traits0

DNA specimens8

eDNA detections7

Sources6 archives

Databases and archives Acaenacis lausus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

Acaenacis lausus is een vliesvleugelig insect uit de familie Pteromalidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1847 door Walker.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acaenacis lausus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P305 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.13%

Haplotypes2

BIN1

Most divergent pair0.33%

Where individuals differ — all 1 variable positions, in barcode order

69Amostly conserved

TATCTTCTAATTTGGCTCATGCTGGTCCATCAGTAGATTTATCTATTTTTTCATTACATATTGCAGGAATTTCTTCAATTATAGGATCAA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 records

Wild obs. + sensor1

Museum / vouchered7

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	7

1 institutions · 7 of 7 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Acaenacis lausus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–20.1

Seasonal swing summer↔winter10.8 °C

Max temp (day)26.0 °C

Min temp (night)15.1 °C

Precipitation94.4 mm/mo

Air humidity56.4 %

Moisture balance-46.0 mm/mo

Vapour deficit1,022 Pa

Wind speed4.40 m/s

Cloud cover35.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)