Acacia julifera

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Acacia

At a glance

Occurrence records391

Data sources10

Biological traits33

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Acacia julifera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility391 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF391 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Acacia holocarpa é uma espécie de leguminosa do gênero Acacia, pertencente à família Fabaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length75 mm

Fruit width3.5 mm

Leaf length125 mm

Leaf length max250 mm

Leaf length min70 mm

Leaf width19 mm

Leaf width max33 mm

Leaf width min5 mm

Plant height7.5 m

Plant height max10 m

Seed length4.5 mm

Seed mass26.36 mg

Seed mass max26.36 mg

Seed mass min26.36 mg

Life cycle & reproduction6

Flowering endAug

Flowering startMar

Flowering timennyyyyyynnnn

Life formshrub or tree

Life spanperennial

Sex typeandromonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

⚠ sources differ — AusTraits: legume · GIFT: nut

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical falcate lanceolate obovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Acacia julifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cyanogenic glycosides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Sambunigrin		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acacia julifera has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKC200892.1 ↗710 bp

ACGT

TCGCGAGAAGTCCACTGAACCTTATCATTTAAAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCG …

Acacia julifera subsp. julifera isolate JM2361 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type391 records

Wild obs. + sensor57

Museum / vouchered133

Cultivated / captive3

Other198

Origin

Native6

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 18≤1 km 9≤10 km 1>10 km 1

29 georeferenced · 28 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 13≤1 km 35≤10 km 52>10 km 8

108 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence133

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	73
James Cook Townsvillelocation not on record	15
Palmerston, AU	12
Kew, GB	9
Mount Annan, AU	5
Kensington, AU	4
Parkville, AU	4
Brisbane, AU	4
Smithfield, AU	2
LDlocation not on record	1
Armidale, AU	1

11 institutions · 130 of 133 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Acacia julifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)