Acacia complanata

A.Cunn. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Acacia

At a glance

Occurrence records1 839

Data sources11

Biological traits42

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Acacia complanata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 839 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources42 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 839 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Acacia complanata, known as long-pod wattle and flat-stemmed wattle, is a perennial tree native to eastern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length150 mm

Fruit width8 mm

Leaf length75 mm

Leaf length max100 mm

Leaf length min50 mm

Leaf mass per area170 g/m2

Leaf size1 100 mm²

⚠ sources differ — TRY: 1 100 mm² · AusTraits: 1 029 mm²

Leaf width21 mm

Leaf width max30 mm

Leaf width min10 mm

Plant height5 m

Plant height max5 m

Plant height min2 m

Seed length4.65 mm

Seed mass43.86 mg

⚠ sources differ — TRY: 43.86 mg · AusTraits: 34.39 mg · GIFT: 42.9 mg

Seed mass max51.5 mg

Seed mass min34.3 mg

Seed width3.65 mm

Life cycle & reproduction9

Deciduousnessdeciduous

Dehiscencedehiscent

Flowering endMar

Flowering startNov

Flowering timeyyynnnnnnnyy

Life formshrub or tree

Life spanperennial

Resprouting capacityresprouts

Sex typeandromonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)5.81 mm²/mg

Wood density572 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Acacia complanata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carboline alkaloids $ Corynanthe type1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Leptocladine		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acacia complanata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes5

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX997277.1 ↗614 bp

ACGT

GGTTGGACGAACCTCTTGACAGCGGGGGGAGGGCGAGGGCGCGCCCGAGTCCTCCCCCGGCAACCACAAACCCCGGCGCCCCAGGCGCCA …

Acacia complanata voucher MEL282085_JK34comQL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 839 records

Wild obs. + sensor1 039

Museum / vouchered527

Cultivated / captive8

Other265

Origin

Native103

Introduced1

Range

Area of Occupancy AOO3 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 679≤1 km 97≤10 km 36>10 km 22

834 georeferenced · 205 without coordinates

Open the mapobservation + sensor1 039

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 120≤1 km 58≤10 km 191>10 km 88

457 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence527

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 5

7 georeferenced · 1 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	199
Mount Annan, AU	103
Museo Entomologico de Leonlocation not on record	81
Canberra, AU	67
Armidale, AU	31
Adelaide, AU	11
Kew, GB	7
Parkville, AU	6
Kensington, AU	6
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Palmerston, AU	2
Wuzhou, CN	1
James Cook Townsvillelocation not on record	1
Hobart, AU	1
University of the Sunshine Coastlocation not on record	1
Smithfield, AU	1

16 institutions · 520 of 527 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Acacia complanata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 17.1–17.1

Seasonal swing summer↔winter8.70 °C

Max temp (day)19.9 °C

Min temp (night)14.5 °C

Precipitation72.1 mm/mo

Air humidity55.1 %

Vapour deficit870 Pa

Cloud cover24.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acacia complanata

At a glance

Sources11 archives

Size & morphology18

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Record type1 839 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 839 records