Acacia cochlearis

(Labill.) H.L.Wendl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Acacia

At a glance

Occurrence records531

Data sources11

Biological traits30

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Acacia cochlearis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF531 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Solitary Acacia cochlearis at Gull Rock National Park Acacia cochlearis blossom in late August Acacia cochlearis thicket under Eucalyptus trees near Two Peoples Bay Nature Reserve Acacia cochlearis, commonly known as the rigid wattle, is a shrub of the genus Acacia and the subgenus Plurinerves. It is native to an area along the coast from the Goldfields-Esperance to the Mid West regions of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length45 mm

Fruit width4 mm

Leaf length35 mm

Leaf width6 mm

Plant height3 m

Plant height max3 m

Plant height min0.5 m

Seed length3 mm

Seed mass7.16 mg

Life cycle & reproduction8

Dispersal typeanimal+self

Flowering timennnnnnyyyynn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typeandromonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical linear narrowly_elliptical oblong subulate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acacia cochlearis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKC200719.1 ↗533 bp

ACGT

CCGCAACCAAACCCCGGCGCCCCAGGCGCCAAGGAACAGAAAACGAAAGCGGGGCGCGCTCGCTGGCGGCCCGGGAACGGTGCCGATCGC …

Acacia cochlearis isolate JM828 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Acacia cochlearis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 263×CCDB · nw-europe-fl · CCDB · book-atlas-flowering-plants · CCDB · kew

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2850

CCDB · book-atlas-flowering-plants

CCDB · kew — Bukhari YM. 1997. Nuclear DNA amounts in Acacia and Prosopis (Mimosaceae) and their evolutionary implications. Hereditas 126: 45-51.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type531 records

Wild obs. + sensor150

Museum / vouchered379

Cultivated / captive2

Origin

Native42

Range

Area of Occupancy AOO1 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 81≤1 km 37≤10 km 9>10 km 9

136 georeferenced · 14 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 29≤1 km 25≤10 km 207>10 km 34

295 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence379

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	182
Museo Entomologico de Leonlocation not on record	75
Mount Annan, AU	38
Canberra, AU	31
Adelaide, AU	26
BGPAlocation not on record	11
Brisbane, AU	8
Kew, GB	2
Joondalup, AU	1
Armidale, AU	1
South Kensington, GB	1
Universität Tübingenlocation not on record	1
Palmerston, AU	1

13 institutions · 378 of 379 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Acacia cochlearis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)