Acacesia hamata

(Hentz, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Acacesia

At a glance

Occurrence records1 030

Data sources9

Biological traits13

DNA specimens13

eDNA detections9

Sources9 archives

Databases and archives Acacesia hamata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 030 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

World Spider Trait DBMasaryk University13 traits · 8 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements8 literature sources13 traits

Occurrence & distributionGBIF1 030 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD13 specimens

01Narrative

Acacesia hamata is a species of spider in the orb weaver family, Araneidae. It is typically found in summer months of the eastern half of the United States, south to Argentina. Acacesia hamata is the only species of Acacesia normally found in the United States. Bugguide species info page Acacesia hamata Hentz, N. M. (1847). Descriptions and figures of the araneides of the United States. Boston Journal of Natural History 5: 443-478.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aFoelix 2011Dias et al. 2010Gonçalves-Souza et al. 2014Podgaiski et al. 2013 Vandewalle et al. 2010Cardoso et al. 2011Pekár et al. 2012a

Morphometry8

Abdomen length♀3.14·♂2.92·Unknown2.1 mm

Abdomen width♀2.87·♂1.77 mm

Cephalothorax height1.5 mm

Cephalothorax length♀3.39·♂2.24·Unknown1.8 mm

Cephalothorax width♀2.62·♂1.78·Unknown1.15 mm

Femur I length♀3.94·♂3.23 mm

Femur IV length♀3.83·♂2.36 mm

Ocular distance♀0.425·♂0.316 mm

Predation2

Hunting guildorb web

Prey diversity4 mm

Ecology2

Circadian activitynocturnal

Microhabitatvegetation

Defence1

Primary defenceCrypsis

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acacesia hamata has left across the world's sequence archives.

At a glance

DNA specimens13

BINs4

Marker genes2

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 114 variable positions, in barcode order

1Avariable

5Tmostly conserved

10Cvariable

14Amostly conserved

16Tmostly conserved

22Avariable

25Tmostly conserved

28Gvariable

29Tmostly conserved

31Tmostly conserved

43Gmostly conserved

73Gmostly conserved

79Gmostly conserved

82Gmostly conserved

88Gmostly conserved

94Tmostly conserved

100Tmostly conserved

106Tvariable

109Gmostly conserved

121Amostly conserved

139Gvariable

145Amostly conserved

163Gvariable

175Gmostly conserved

181Gmostly conserved

184Gmostly conserved

190Gmostly conserved

202Cmostly conserved

205Amostly conserved

206Tvariable

211Amostly conserved

214Avariable

217Amostly conserved

226Tmostly conserved

244Avariable

251Tmostly conserved

253Amostly conserved

259Tmostly conserved

262Amostly conserved

263Tmostly conserved

265Amostly conserved

266Tmostly conserved

268Amostly conserved

271Amostly conserved

274Cvariable

277Tmostly conserved

280Gmostly conserved

281Cmostly conserved

283Tmostly conserved

286Gmostly conserved

287Cmostly conserved

289Tmostly conserved

292Cvariable

294Cmostly conserved

295Amostly conserved

307Gmostly conserved

310Gmostly conserved

313Gmostly conserved

316Gvariable

319Tvariable

322Gmostly conserved

325Tmostly conserved

328Gmostly conserved

337Gmostly conserved

346Tvariable

347Cmostly conserved

353Tmostly conserved

354Cmostly conserved

355Tmostly conserved

358Amostly conserved

373Amostly conserved

376Tmostly conserved

382Gvariable

391Amostly conserved

400Tmostly conserved

407Tmostly conserved

412Tmostly conserved

415Gmostly conserved

421Tmostly conserved

433Gvariable

442Tmostly conserved

493Gmostly conserved

502Gmostly conserved

508Gvariable

514Amostly conserved

517Cmostly conserved

526Gmostly conserved

532Tmostly conserved

533Tmostly conserved

539Tmostly conserved

542Cmostly conserved

544Tmostly conserved

553Amostly conserved

556Amostly conserved

562Tmostly conserved

565Amostly conserved

571Cmostly conserved

574Amostly conserved

580Amostly conserved

610Tmostly conserved

616Tmostly conserved

619Amostly conserved

622Amostly conserved

625Avariable

628Gmostly conserved

631Gvariable

634Tmostly conserved

637Amostly conserved

638Gmostly conserved

640Tmostly conserved

643Amostly conserved

646Tmostly conserved

649Gmostly conserved

655Gvariable

AACATTATACTTAATTTTTGGAGCTTGGTCTGCTATAGTAGGGACTGCAATAAGAGTTTTAATTCGAATTGAGTTAGGGCAGCCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes5

BINs4

Most divergent pair14.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona subfuscasame family11.9%Neoscona cruciferasame family12.3%Verrucosa tarapoasame family12.4%Araneus partitussame family12.5%Paraplectana sakaguchiisame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type1 030 records

Wild obs. + sensor894

Museum / vouchered102

Other34

Range

Area of Occupancy AOO2 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 338≤1 km 192≤10 km 49>10 km 114

693 georeferenced · 201 without coordinates

Open the mapobservation + sensor894

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 17≤1 km 16≤10 km 26>10 km 2

61 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	32
Mexico City, MX	17
Ohio State University Acarology Laboratorylocation not on record	10
Washington, US	8
Ciudad de México, MX	8
Champaign, US	7
Denver, US	4
Museu Paraense Emílio Goeldilocation not on record	4
PUC-RSlocation not on record	3
Museo Nacional de Historia Natural "Prof. Eugenio de Jesús Marcano"location not on record	2
US	2
Cambridge, US	1
Albuquerque, US	1
Cincinnati, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Frankfurt am Main	1

16 institutions · 102 of 102 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Acacesia hamata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

Shrubbery and garageMixed Hardwoods

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.6 °C 23.7–28.2

Seasonal swing summer↔winter20.6 °C

Max temp (day)33.0 °C 27.5–33.5

Min temp (night)23.2 °C 19.2–24.2

Precipitation87.0 mm/mo 66.9–132

Air humidity57.6 % 55.2–61.3

Moisture balance-94.7 mm/mo -127–-35.9

Vapour deficit1,510 Pa 1,117–1,696

Wind speed3.30 m/s 2.10–4.00

Cloud cover29.3 % 27.2–32.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acacesia hamata

At a glance

Sources9 archives

Morphometry8

Predation2

Ecology2

Defence1

At a glance

Record type1 030 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 030 records