Abylopsis tetragona

(Otto, 1823) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Siphonophorae/Abylidae/Abylopsis

At a glance

Occurrence records7 290

Data sources9

Biological traits4

DNA specimens8

eDNA detections26

Sources9 archives

Databases and archives Abylopsis tetragona's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 613 records↗

OBISOcean Biodiversity Information System3 677 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS7 290 records

Environmental DNA2 datasets · 2 countries26 detections

DNA & barcodingBOLD8 specimens

01Narrative

Abylopsis tetragona is a species of siphonophore in the family Abylidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max200 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abylopsis tetragona has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections26

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P603 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

19Cmostly conserved

31Tmostly conserved

118Tmostly conserved

290Cvariable

323Amostly conserved

343Avariable

529Cmostly conserved

TGTTTTATATATATTATTCGGGCTTTTCAGTTGCCTATTAGGTAGTAGTCTTTCAGGTATGATTCGTTATGAATTGTCTAGTAGTGAAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes4

BIN1

Most divergent pair1.2%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_080938 ↗ · 12 protein · 2 rRNA

COX2COX1COX3CYTBND4LND4ND6ND3ND1ND5ATP6ND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type7 290 records

Wild obs. + sensor5 160

Museum / vouchered1 572

Cultivated / captive6

Other552

Range

Area of Occupancy AOO5 324 km²

Depth

0–200 m sunlit2 591

200–1000 m twilight414

1–4 km midnight57

>4 km abyssal7

median 37.5 m · max 4 733 m · 3 069 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 24

28 georeferenced · 5 132 without coordinates

Open the mapobservation + sensor5 160

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 459≤1 km 89≤10 km 6>10 km 186

740 georeferenced · 832 without coordinates

Open the institutions mapphysical evidence1 572

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	439
South Kensington, GB	99
Washington, US	83
Okinawa Institute for Science and Technologylocation not on record	59
Ciudad de México, MX	8
	8
JAMSTEClocation not on record	7
National Institute of Biological Resourceslocation not on record	5
CSIRO, Australialocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	1
Museo de Zoología de la Universidad de Concepción (UCCC_MZUC)location not on record	1
Barcelona, ES	1
University of Floridalocation not on record	1
IPMAlocation not on record	1
University of California San Diegolocation not on record	1

16 institutions · 719 of 1 572 vouchered records shown · 229 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA26 detections

Where the DNA of Abylopsis tetragona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys2

Countries2

Verifiable raw sequence linked15

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 20.4–24.5

Seasonal swing summer↔winter6.10 °C

Max temp (day)23.9 °C 21.0–25.2

Min temp (night)22.1 °C 19.8–23.8

Precipitation60.4 mm/mo 58.5–93.2

Air humidity59.4 % 59.0–64.9

Vapour deficit1,122 Pa 976–1,270

Cloud cover33.1 % 32.2–37.3

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abylopsis tetragona

At a glance

Sources9 archives

Habitat & environment2

Other traits2

At a glance

Record type7 290 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 290 records