Absidia glauca

Hagem · species

image placeholder — illustration coming later

Fungi/Mucoromycota/Mucoromycetes/Mucorales/Cunninghamellaceae/Absidia

At a glance

Occurrence records991

Data sources10

Biological traits0

DNA specimens20

eDNA detections1 787

Sources10 archives

Databases and archives Absidia glauca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility991 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 787 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF991 records

Environmental DNA11 datasets · 30 countries1 787 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceGoaT · NCBI≈49 Mbp

01Narrative

Absidia glauca is a species of fungi belonging to the family Cunninghamellaceae. It has cosmopolitan distribution.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Absidia glauca has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes2

GenBank sequences10

eDNA detections1 787

Countries30

The DNA barcodea real sequence read deposited for this species

ITSON075116.1 ↗210 bp

ACGT

GGTGGCAACACCCGGGCCTGGAAGAGAACTATGGCAAACTAGATTATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACC …

Absidia glauca isolate MIAE07971 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Absidia glauca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈48 746 359 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Absidia glauca0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.7% BUSCO

08Occurrence & distribution

Record type991 records

Wild obs. + sensor9

Museum / vouchered982

Range

Area of Occupancy AOO1 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤1 km 2≤10 km 7

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 9≤1 km 2>10 km 1

12 georeferenced · 970 without coordinates

Open the institutions mapphysical evidence982

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sorbonne Universitélocation not on record	7
DPIlocation not on record	6
Catholic University of Pekinglocation not on record	3
Bronx, US	1
Philadelphia, US	1
UAclocation not on record	1

6 institutions · 19 of 982 vouchered records shown · 958 without an institution code

09Environmental DNA1 787 detections

Where the DNA of Absidia glauca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 787

Studies independent surveys11

Countries30

Verifiable raw sequence linked9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 787 detections have coordinates

Open the map30 countries0

PalearcticAfrotropicNearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 7.00–29.0

pH5.50 3.10–9.50

Conductivity61.0 µS/cm 11.0–4,900

Organic carbon2.86 % 0.003–6.48

Water content15.6 % 0.365–109

Nitrate-N7.00 mg/kg 0.006–284

Phosphorus15.0 mg/kg 1.00–400

Clay15.4 % 0.99–64.9

Sand69.1 % 7.20–97.1

Depth0 m 0–1.02

SoilMarineVertosolTenosolPodosolKurosolKurosolsChromosol

656 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 6.70–17.9

Seasonal swing summer↔winter20.4 °C

Max temp (day)18.5 °C 9.80–22.4

Min temp (night)9.20 °C 3.90–14.7

Precipitation70.8 mm/mo 42.8–105

Air humidity60.5 % 56.0–64.8

Moisture balance-18.1 mm/mo -78.4–50.7

Vapour deficit662 Pa 367–848

Wind speed3.30 m/s 2.20–4.80

Cloud cover38.4 % 17.9–54.1

CHELSA 1981–2010, ~9 km grid, at location & month of 1 760 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)