Abrus precatorius
speciesAt a glance
Occurrence records9 026
Data sources15
Biological traits57
DNA specimens44
eDNA detections33
Sources15 archives
Databases and archives Abrus precatorius's data was compiled from.
WikipediaWikimedia Foundation22 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 026 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources57 traits
Chemical compositionLOTUS · NPASS180 compounds
Occurrence & distributionGBIF9 026 records
Environmental DNA1 datasets · 8 countries33 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB · GIFT · GoaT≈347 Mbp
01Narrative
Abrus precatorius, commonly known as jequirity bean or rosary pea, is a herbaceous flowering plant in the bean family Fabaceae. It is a slender, perennial climber with long, pinnate-leafleted leaves that twines around trees, shrubs, and hedges. The plant is best known for its seeds, which are used as beads and in percussion instruments, and which are toxic because of the presence of abrin. Ingestion of a single seed, well chewed, can be fatal to both adults and children. The plant is native to Asia and Australia. It has a tendency to become weedy and invasive where it has been introduced.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology25
Fruit length36.5 mm
Fruit length max50 mm
Fruit length min20 mm
Fruit width13 mm
Fruit width max15 mm
Fruit width min10 mm
Inflorescence length max10 cm
Leaf length15 mm
Leaf length max27 mm
Leaf length min5 mm
Leaf width5.5 mm
Leaf width max10 mm
Leaf width min3 mm
Plant height3.17 m
⚠ sources differ — GIFT: 3.17 m · AusTraits: 10 m
Plant height max9 m
Plant height min0.5 m
Seed length6 mm
Seed length max7 mm
Seed length min5 mm
Seed mass87.34 mg
⚠ sources differ — TRY: 87.34 mg · AusTraits: 77.23 mg · GIFT: 81.08 mg
Seed mass max108 mg
Seed mass min44.97 mg
Seed width4.5 mm
Seed width max5 mm
Seed width min4 mm
Life cycle & reproduction10
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typewater
Flower colourpink
Flowering timenyyyynnnnnnn
Life formclimbing shrub
Life spanperennial
Raunkiær life formphanerophyte
Resprouting capacityresprouts
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberobligatory
Elevation max2 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: climber_herbaceous · TRY: Climber
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga
Leaf compoundnesscompound
Leaf shapeovate
Mycorrhiza typearbuscular
Succulenceno
Woodinesswoody
Physiology & chemistry4
Leaf dry-matter content (LDMC)463 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)35.99 mm²/mg
Other traits2
Seeds per fruit1-10
Shoot orientationscandent
03Chemical composition180 compounds
Compounds documented for Abrus precatorius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Caryophyllane sesquiterpenoids29
Oleanane triterpenoids26
Flavones22
Cycloartane triterpenoids13
Dibenzocyclooctadienes lignans7
Documented compounds180 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Abscisic acid | present | NPASS | |
| (1R,4R,9R)-4-(hydroxymethyl)-11,11-dimethyl-8-methylidenebicyclo[7.2.0]undecan-3-one | present | NPASS | |
| (1R,4R,9R,11R)-4,11-bis(hydroxymethyl)-11-methyl-8-methylidenebicyclo[7.2.0]undecan-3-one | present | NPASS | |
| (1R,4S,5S,9R,11S)-11-(hydroxymethyl)-5-methoxy-4-(methoxymethyl)-11-methyl-8-methylidenebicyclo[7.2.0]undecan-3-one | present | NPASS | |
| (1R,4Z,9R)-4-(methoxymethyl)-11,11-dimethyl-8-methylidenebicyclo[7.2.0]undec-4-en-3-one | present | NPASS | |
| (1R,4Z,9R,11S)-4,11-bis(hydroxymethyl)-11-methyl-8-methylidenebicyclo[7.2.0]undec-4-en-3-one | present | NPASS | |
| (1R,5R,9R)-5-methoxy-11,11-dimethyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | NPASS | |
| (1R,5R,9R,11R)-5-hydroxy-11-(hydroxymethyl)-11-methyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | NPASS | |
| (1R,5R,9R,11S)-5-hydroxy-11-(hydroxymethyl)-11-methyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | NPASS | |
| (1R,5S,9R)-5-methoxy-11,11-dimethyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | NPASS |
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abrus precatorius has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes8
GenBank sequences10
eDNA detections33
Countries9
The DNA barcodea real sequence read deposited for this species
TGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCAC …
Abrus precatorius voucher CIMAP:AP2 S2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL7★rbcLa★trnL★trnL-F★ITS2★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Abrus precatorius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈347 230 236 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Abrus precatorius0.35 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidy2× diploid · measured
Chromosome records22–222n range22median22mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 229×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Borgen, L. 1980. Chromosome numbers of Macaronesian flowering plants III. Bot. Macaronés. IV, Cien. 7: 67–76.
CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · ipcn-api-dl — Al-Turki, T. A., S. A. Filfilan & S. F. Mehmood. 2000. A cytological study of flowering plants from Saudi Arabia. Willdenowia 30: 339–358.
CCDB · book-ipcn73-74 — FRITSCH, R. 1972. Chromosomenzahlen von Pflanzen der Insel Kuba. II. Kulturpflanze 19: 305-313.
CCDB · book-indian_vol1 — Tschechow, W.P. (Pedorov) ; Senn, H.A. 1938 ; Poucques, M.L. de 1945a; Riley; H.P. 1960 ; Von Rein- hard, F. 1972
CCDB · book-atlas-flowering-plants — Senn 1938,
GIFT · GIFT (floras)
n 114×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cannon, 2015
CCDB · ipcn-api-dl — Gill, L. S. & S. W. Husaini. 1986. Cytological observations in Leguminosae from southern Nigeria. Willdenowia 15: 521–527.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · book-ipcn75-78 — Bir & Kumari 1977
CCDB · Cannon, 2015 — Gill, L. S. & S. W. Husaini, 1986
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness98.5% BUSCO
08Occurrence & distribution
Record type9 026 records
Wild obs. + sensor6 878
Museum / vouchered1 811
Cultivated / captive17
Other320
Origin
Native18
Introduced182
Range
Area of Occupancy AOO18 648 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 3 286≤1 km 832≤10 km 397>10 km 327
4 842 georeferenced · 2 036 without coordinates
Open the mapobservation + sensor6 878
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 90≤1 km 34≤10 km 66>10 km 26
216 georeferenced · 1 595 without coordinates
Open the institutions mapphysical evidence1 811
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 1
3 georeferenced · 14 without coordinates
Open the mapnot free-living17
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions104 of 236 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 108 |
| Bronx, US | 82 |
| Kew, GB | 60 |
| Tampa, US | 55 |
| Taipei, TW | 49 |
| MeiseBGlocation not on record | 48 |
| Durango, MX | 37 |
| University of Stellenboschlocation not on record | 37 |
| Xiamen, CN | 32 |
| Salvador, BR | 31 |
| Instituto de Investigação Científica Tropicallocation not on record | 30 |
| Guangzhou, CN | 25 |
| UFESlocation not on record | 24 |
| UFBAlocation not on record | 23 |
| Leiden University Medical Centerlocation not on record | 23 |
| Guilin, CN | 21 |
| Kunming, CN | 20 |
| JBRJlocation not on record | 20 |
| HNBlocation not on record | 19 |
| Miami, US | 19 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 18 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 17 |
| Federal University of Espírito Santolocation not on record | 17 |
| LSF/FSA/UAClocation not on record | 17 |
| Kensington, AU | 17 |
| Beijing, CN | 16 |
| Universidade Federal do Maranhãolocation not on record | 16 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 14 |
| Laboratorio de Ictiologialocation not on record | 14 |
| Puerto Ayora, EC | 14 |
| Chicago, US | 13 |
| Honolulu, US | 12 |
| Tsukuba, JP | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 11 |
| Pondicherry, IN | 11 |
| Departamento de Sistematica e Ecologialocation not on record | 11 |
| TAIElocation not on record | 11 |
| Jena Microbial Resource Collectionlocation not on record | 11 |
| Mérida, MX | 9 |
| Yaoundé, CM | 9 |
| LDlocation not on record | 9 |
| Adelaide, AU | 9 |
| Paris, FR | 9 |
| Frankfurt am Main | 8 |
| Plocation not on record | 8 |
| Auckland, NZ | 8 |
| James Cook Townsvillelocation not on record | 8 |
| Blumenau, BR | 8 |
| UFSCarlocation not on record | 8 |
| Université du Lomélocation not on record | 8 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 8 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 7 |
| Universidade Federal do Espírito Santolocation not on record | 7 |
| Cenargenlocation not on record | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 6 |
| Brisbane, AU | 6 |
| WAGlocation not on record | 6 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 6 |
| Brasília, BR | 6 |
| Tapachula, MX | 6 |
| Christchurch, NZ | 6 |
| CEPLAClocation not on record | 6 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 6 |
| St. Paul, US | 5 |
| South Kensington, GB | 5 |
| Chaguaramas, TT | 5 |
| UFERSAlocation not on record | 5 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 5 |
| Stockholm, SE | 5 |
| Feira de Santana, BR | 5 |
| CNF-UFHBlocation not on record | 5 |
| BISHlocation not on record | 5 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 5 |
| LSFlocation not on record | 4 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 4 |
| Fort Worth, US | 4 |
| Baroda, IN | 4 |
| Mount Annan, AU | 4 |
| Universidad de Antioquia (UdeA)location not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Uppsala, SE | 4 |
| UFMSlocation not on record | 4 |
| HUENFlocation not on record | 4 |
| LBVlocation not on record | 4 |
| Mexico City, MX | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| ESALQlocation not on record | 4 |
| Chongqing Museumlocation not on record | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Université de Strasbourglocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Philadelphia, US | 3 |
| Austin, US | 3 |
| UFRRJlocation not on record | 3 |
| National Herbarium of São Tomé and Principelocation not on record | 3 |
| Cruz das Almas, BR | 3 |
| Fortaleza, BR | 3 |
| UFMGlocation not on record | 3 |
| Universidade Federal de Goiáslocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| BRLUlocation not on record | 3 |
| Mérida, MX | 3 |
| BGPAlocation not on record | 3 |
| IECOSlocation not on record | 3 |
| UNESP-ISlocation not on record | 3 |
| EFGlocation not on record | 3 |
| Universidade de São Paulolocation not on record | 3 |
| Bloomington, US | 3 |
| Nanjing, CN | 3 |
| Porto Alegre, BR | 2 |
| UFPIlocation not on record | 2 |
| Trondheim, NO | 2 |
| Guangzhou, CN | 2 |
| UFSClocation not on record | 2 |
| Seropédica, BR | 2 |
| MAlocation not on record | 2 |
| Zürich, CH | 2 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 2 |
| Dehra Dun, IN | 2 |
| Bangkok, TH | 2 |
| Toronto, CA | 2 |
| Kagoshima, JP | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Brasília, BR | 2 |
| Yangling, CN | 2 |
| Ivano-Frankivsk, UA | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Ojo, NG | 2 |
| ASUlocation not on record | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Taipei, TW | 2 |
| Nishihara, JP | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| Montréal, CA | 2 |
| Dresden, DE | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 2 |
| Universidad del Valle (UniValle)location not on record | 2 |
| Chengdu, CN | 2 |
| Pretoria, ZA | 2 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 2 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 2 |
| Burlington, US | 2 |
| Taipei, TW | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Cambridge, US | 2 |
| Wuhan, CN | 2 |
| Fredericksburg, US | 2 |
| Claremont, US | 2 |
| San Francisco de Campeche, MX | 1 |
| Peking Universitylocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Nagano City, JP | 1 |
| Daubeny Herbarium, Oxfordlocation not on record | 1 |
| University of the Sunshine Coastlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Masindi, UG | 1 |
| Chapel Hill, US | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Richmond, US | 1 |
| UNESClocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Ann Arbor, US | 1 |
| Nishihara, JP | 1 |
| Santiago de Cali, CO | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| La Paz, BO | 1 |
| MEXUlocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 1 |
| Clemson, US | 1 |
| Dekalb, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Guangxi Agricultural Universitylocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| IPHAMETRAlocation not on record | 1 |
| Tempe, US | 1 |
| UNITINSlocation not on record | 1 |
| Moscow, US | 1 |
| Wlocation not on record | 1 |
| INMAlocation not on record | 1 |
| UFPElocation not on record | 1 |
| Guasave, MX | 1 |
| Santa Teresa, BR | 1 |
| Durban, ZA | 1 |
| Mount Makulu Central Research Stationlocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| Larsen, K. (AAU), 1995.location not on record | 1 |
| Monastir, TN | 1 |
| Criciúma, BR | 1 |
| Hobart, AU | 1 |
| SNJB's KKHA Arts, SMGL Commerce & SPHJ Science College Chandwad, Dist. Nashik, Maharashtra, India. 423101.location not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| UFRPElocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| UERJlocation not on record | 1 |
| Juriquilla, MX | 1 |
| Teresina, BR | 1 |
| UnBlocation not on record | 1 |
| Division of Forest Researchlocation not on record | 1 |
| Coimbra, PT | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| HUAlocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Glocation not on record | 1 |
| Canberra, AU | 1 |
| HACAMlocation not on record | 1 |
| FLASlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Göteborg, SE | 1 |
| Chadron, US | 1 |
| Santa Barbara, US | 1 |
| Millersville, US | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 1 |
236 institutions · 1 549 of 1 811 vouchered records shown · 258 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA33 detections
Where the DNA of Abrus precatorius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found33
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 33 detections have coordinates
Open the map8 countries0
Disturbed Mixed miombo Woodland/agriculture …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.8 °C 20.5–27.1
Seasonal swing summer↔winter7.10 °C
Max temp (day)30.1 °C 22.1–31.6
Min temp (night)20.2 °C 15.0–21.9
Precipitation108 mm/mo 15.6–328
Air humidity59.8 % 43.4–69.4
Moisture balance-28.1 mm/mo -143–252
Vapour deficit1,339 Pa 751–1,624
Wind speed2.80 m/s 1.00–4.00
Cloud cover29.9 % 18.1–49.9
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.