Abrostola microvalis

Ottolengui, 1919 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abrostola

At a glance

Occurrence records283

Data sources7

Biological traits0

DNA specimens12

eDNA detections7

Sources7 archives

Databases and archives Abrostola microvalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility283 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF283 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD12 specimens

01Narrative

Abrostola microvalis, the minute oval abrostola, is a species of looper moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Abrostola microvalis is 8883.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abrostola microvalis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

412Avariable

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTACTTATTCGTGCAGAATTAGGTACCCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abrostola parvulasame genus4.0%Abrostola tripartitasame genus7.1%Marimatha quadratasame family7.1%Mycteroplus puniceagosame family7.3%Euchalcia emichisame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type283 records

Wild obs. + sensor255

Museum / vouchered28

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 160≤1 km 27≤10 km 2>10 km 21

210 georeferenced · 45 without coordinates

Open the mapobservation + sensor255

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
Smithsonian Institution, National Museum of Natural Historylocation not on record	5
US	2
St. Paul, US	1

4 institutions · 28 of 28 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Abrostola microvalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 22.9–25.1

Seasonal swing summer↔winter24.1 °C

Max temp (day)30.3 °C 29.9–30.7

Min temp (night)19.1 °C 17.8–20.4

Precipitation101 mm/mo 90.9–111

Air humidity54.9 % 53.8–56.0

Moisture balance-86.4 mm/mo -87.4–-85.3

Vapour deficit1,354 Pa 1,297–1,412

Wind speed4.40 m/s 4.20–4.60

Cloud cover32.5 % 30.8–34.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)