Abronica purpureoanulata

(Baba, 1961) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Abronicidae/Abronica

At a glance

Occurrence records190

Data sources8

Biological traits2

DNA specimens5

eDNA detections3

Sources8 archives

Databases and archives Abronica purpureoanulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 records↗

OBISOcean Biodiversity Information System89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS190 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD5 specimens

01Narrative

Abronica purpureoanulata is a species of sea slug, an aeolid nudibranch, a marine gastropod mollusc in the family Fionidae.MolluscaBase (2018). Abronica purpureoanulata (Baba, 1961). Accessed through: World Register of Marine Species at: http://www.marinespecies.org/aphia.php?p=taxdetails&id=1036951 on 2019-01-16

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abronica purpureoanulata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes2

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Diversity (π)8.0%

Haplotypes1

BINs2

Where individuals differ — all 104 variable positions, in barcode order

5Tmostly conserved

7Gmostly conserved

16Cmostly conserved

23Tmostly conserved

35Tmostly conserved

37Amostly conserved

40Cmostly conserved

49Tmostly conserved

59Tmostly conserved

79Gmostly conserved

85Cvariable

97Tmostly conserved

110Cmostly conserved

112Tmostly conserved

115Tmostly conserved

127Tmostly conserved

133Amostly conserved

139Cmostly conserved

172Amostly conserved

181Gmostly conserved

187Cvariable

193Tmostly conserved

199Amostly conserved

206Tmostly conserved

208Amostly conserved

209Cmostly conserved

211Gmostly conserved

217Amostly conserved

223Tmostly conserved

232Tmostly conserved

238Tmostly conserved

241Gmostly conserved

250Tmostly conserved

262Gmostly conserved

266Tmostly conserved

271Amostly conserved

283Avariable

292Amostly conserved

296Tmostly conserved

297Cmostly conserved

301Amostly conserved

302Cmostly conserved

316Gmostly conserved

325Tmostly conserved

328Gmostly conserved

331Gmostly conserved

337Gmostly conserved

346Cmostly conserved

352Gmostly conserved

355Cvariable

358Tmostly conserved

370Tmostly conserved

373Tmostly conserved

379Gmostly conserved

391Amostly conserved

400Amostly conserved

407Tmostly conserved

409Gmostly conserved

418Amostly conserved

425Tmostly conserved

427Gmostly conserved

433Gmostly conserved

451Amostly conserved

454Tmostly conserved

466Amostly conserved

469Tmostly conserved

472Cmostly conserved

475Tmostly conserved

479Tmostly conserved

484Amostly conserved

490Cmostly conserved

493Tmostly conserved

494Cmostly conserved

496Tmostly conserved

499Tmostly conserved

500Tmostly conserved

505Tmostly conserved

508Amostly conserved

514Amostly conserved

523Gmostly conserved

529Cmostly conserved

539Tmostly conserved

541Gmostly conserved

547Amostly conserved

548Cmostly conserved

550Gmostly conserved

553Tmostly conserved

565Amostly conserved

568Cmostly conserved

574Tmostly conserved

577Amostly conserved

578Tmostly conserved

580Amostly conserved

581Cmostly conserved

586Gmostly conserved

595Cmostly conserved

598Cmostly conserved

610Cmostly conserved

613Tmostly conserved

622Amostly conserved

625Gmostly conserved

628Cmostly conserved

652Cmostly conserved

655Gmostly conserved

CACTTTGTATGTGCTCTTAGGGTTATGGTGTGGGTTAGTCGGTACTGGTTTAAGTTTATTAATTCGATTTGAGTTAGGGACAGCCGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Noumeaella rehderisame order16.5%Doto antarcticasame order16.6%Xenocratena suecicasame order17.0%Doto koenneckerisame order17.8%Cuthonella cocoachromasame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PH3

animal barcodemarker

08Occurrence & distribution

Record type190 records

Wild obs. + sensor177

Museum / vouchered13

Range

Area of Occupancy AOO208 km²

Depth

0–200 m sunlit80

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8.5 m · max 30 m · 80 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 129≤1 km 19≤10 km 27>10 km 2

177 georeferenced

Open the mapobservation + sensor177

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
CASlocation not on record	5
Toyohashi Museum Of Natural Historylocation not on record	3

2 institutions · 8 of 13 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Abronica purpureoanulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)