Abraximorpha davidii

(Mabille, 1876) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Abraximorpha

At a glance

Occurrence records262

Data sources6

Biological traits0

DNA specimens17

eDNA detections20

Sources6 archives

Databases and archives Abraximorpha davidii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF262 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD17 specimens

01Narrative

Abraximorpha davidii is een vlinder uit de familie van de dikkopjes (Hesperiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1876 door Mabille.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abraximorpha davidii has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections20

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

23Amostly conserved

38Gmostly conserved

250Tmostly conserved

254Amostly conserved

301Cvariable

328Tmostly conserved

340Cmostly conserved

346Amostly conserved

347Cmostly conserved

349Tmostly conserved

373Amostly conserved

374Gmostly conserved

376Tmostly conserved

379Amostly conserved

401Cmostly conserved

403Tmostly conserved

412Tmostly conserved

415Gvariable

421Tmostly conserved

451Amostly conserved

475Amostly conserved

499Cmostly conserved

500Cmostly conserved

505Cmostly conserved

517Tmostly conserved

520Tmostly conserved

529Amostly conserved

542Cmostly conserved

544Tmostly conserved

548Cmostly conserved

550Tmostly conserved

556Tmostly conserved

565Tmostly conserved

580Tmostly conserved

592Tmostly conserved

596Cmostly conserved

598Tmostly conserved

607Amostly conserved

622Avariable

625Tmostly conserved

628Gmostly conserved

634Cmostly conserved

637Cmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAACAGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes5

BIN1

Most divergent pair0.91%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coladenia hoeneisame family8.4%Telemiades austinisame family9.3%Crocidolomia suffusalissame order9.7%Actinotia intermediatasame order9.9%Pintara bowringisame family10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_053717 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type262 records

Wild obs. + sensor254

Museum / vouchered7

Other1

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 71≤1 km 65≤10 km 32>10 km 42

210 georeferenced · 44 without coordinates

Open the mapobservation + sensor254

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	5
Tartu, EE	1

2 institutions · 6 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA20 detections

Where the DNA of Abraximorpha davidii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 21.3–28.0

Seasonal swing summer↔winter13.3 °C

Max temp (day)28.6 °C 23.9–29.5

Min temp (night)22.4 °C 17.2–25.5

Precipitation312 mm/mo 121–444

Air humidity66.5 % 59.3–69.9

Moisture balance173 mm/mo -29.6–312

Vapour deficit1,195 Pa 763–1,387

Wind speed2.20 m/s 1.60–2.70

Cloud cover50.2 % 29.7–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)