Abraxas sylvata

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Abraxas

At a glance

Occurrence records33 548

Data sources9

Biological traits0

DNA specimens39

eDNA detections36

Sources9 archives

Databases and archives Abraxas sylvata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 548 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 548 records

Environmental DNA2 datasets · 11 countries36 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceGoaT · NCBI≈475 Mbp

01Narrative

Abraxas sylvata, la Zérène de l'orme, est une espèce de lépidoptères (papillons) de la famille des Geometridae, de la sous-famille des Ennominae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abraxas sylvata has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes1

eDNA detections36

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

94Amostly conserved

316Gmostly conserved

322Gmostly conserved

578Cmostly conserved

616Tmostly conserved

628Amostly conserved

AACACTATATTTTATTTTTGGAATTTGAGCTGGTATACTAGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes11

BINs2

Most divergent pair6.4%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abraxas tenuisuffusasame genus4.6%Abraxas sublepidasame genus5.2%Abraxas pusillasame genus5.4%Abraxas peregrinasame genus5.5%Abraxas latifasciatasame genus6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Abraxas sylvata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈475 200 814 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Abraxas sylvata0.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.2% BUSCO

08Occurrence & distribution

Record type33 548 records

Wild obs. + sensor29 979

Museum / vouchered3 246

Other323

Origin

Native61

Range

Area of Occupancy AOO35 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 8 709≤1 km 4 028≤10 km 14 910>10 km 167

27 814 georeferenced · 2 165 without coordinates

Open the mapobservation + sensor29 979

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 1 647≤1 km 519≤10 km 465>10 km 53

2 684 georeferenced · 562 without coordinates

Open the institutions mapphysical evidence3 246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	1 562
South Kensington, GB	347
Tartu, EE	120
Zürich, CH	118
Salzburg, AT	107
Kuopio, FI	78
Philadelphia, US	52
Muzeum Górnośląskie w Bytomiulocation not on record	41
Natural History Museum Rotterdamlocation not on record	39
ZMAAlocation not on record	34
NHMOlocation not on record	34
Helsinki, FI	27
SLU Artdatabankenlocation not on record	26
NCMGlocation not on record	25
Provincia di Livornolocation not on record	24
Tallinn, EE	22
Nijmegen, NL	15
Durban Natural Science Museumlocation not on record	13
DABUHlocation not on record	13
CBDClocation not on record	9
NTNU-VMlocation not on record	8
ZSMlocation not on record	5
Metsähallituslocation not on record	5
MZLUlocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	4
Bavarian State Collection of Zoologylocation not on record	3
Rovaniemi, FI	2
New Haven, US	2
Uniwersytet Jagiellońskilocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Ugentlocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
HUNMlocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Stockholm, SE	1
University of Oslo, Natural History Museumlocation not on record	1
Research Collection of Bernard Dardennelocation not on record	1
BioFokuslocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

40 institutions · 2 756 of 3 246 vouchered records shown · 490 without an institution code

09Environmental DNA36 detections

Where the DNA of Abraxas sylvata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys2

Countries11

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 4.50–18.7

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.7 °C 7.30–22.9

Min temp (night)10.1 °C 1.50–14.1

Precipitation77.5 mm/mo 58.4–179

Air humidity62.2 % 58.1–65.8

Moisture balance-27.4 mm/mo -66.2–73.6

Vapour deficit657 Pa 375–913

Wind speed2.80 m/s 2.00–4.90

Cloud cover38.0 % 28.8–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abraxas sylvata

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type33 548 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type33 548 records