Abraxas miranda

Butler, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Abraxas

At a glance

Occurrence records136

Data sources8

Biological traits0

DNA specimens5

eDNA detections1

Sources8 archives

Databases and archives Abraxas miranda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF136 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

01Narrative

Abraxas miranda is a species of moth belonging to the family Geometridae. It was described by Arthur Gardiner Butler in 1878. It is known from Japan. The wingspan is 18–26 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abraxas miranda has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

202Tmostly conserved

214Amostly conserved

433Amostly conserved

439Tmostly conserved

643Tmostly conserved

653Tmostly conserved

655Amostly conserved

656Tmostly conserved

AACACTATATTTTATTTTTGGAATTTGAGCTGGCATATTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes3

BIN1

Most divergent pair1.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abraxas tenuisuffusasame genus5.0%Abraxas pusillasame genus5.0%Abraxas sublepidasame genus5.2%Abraxas peregrinasame genus6.2%Abraxas latifasciatasame genus6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type136 records

Wild obs. + sensor58

Museum / vouchered78

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 6≤1 km 5>10 km 1

12 georeferenced · 46 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 48≤1 km 4≤10 km 3

55 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hiwa Museum of Natural Historylocation not on record	48
Kawasaki Shi Tama Ku, JP	13
Sagamihara, JP	8
Tartu, EE	4
New Haven, US	3
Ishikawa Museum of Natural Historylocation not on record	2

6 institutions · 78 of 78 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Abraxas miranda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)