Abraxas lugubris

Prout, 1925 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Abraxas

At a glance

Occurrence records5

Data sources7

Biological traits0

DNA specimens11

eDNA detections12

Sources7 archives

Databases and archives Abraxas lugubris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD11 specimens

01Narrative

Abraxas lugubris is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1925 door Prout.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abraxas lugubris has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 6 variable positions, in barcode order

34Tmostly conserved

266Cmostly conserved

421Amostly conserved

523Cmostly conserved

562Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATACTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACCCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abraxas sublepidasame genus6.4%Acrotomodes clotasame family7.4%Ectropis ligneasame family7.6%Petelia paroobathrasame family7.8%Agathiopsis basipunctasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 records

Wild obs. + sensor3

Museum / vouchered2

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Natural History Museum of Utahlocation not on record	1
Smithsonian Tropical Research Institute, Center for Tropical Forest Science, Khao Chong, Arthropod Laboratorylocation not on record	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Abraxas lugubris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 25.0–27.4

Seasonal swing summer↔winter2.00 °C

Max temp (day)29.6 °C 28.5–30.7

Min temp (night)23.7 °C 21.1–24.0

Precipitation219 mm/mo 198–288

Air humidity68.5 % 67.3–69.2

Moisture balance76.0 mm/mo 62.9–139

Vapour deficit1,085 Pa 1,013–1,167

Wind speed1.90 m/s 1.40–2.10

Cloud cover67.3 % 34.2–70.6

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)