Abraxas karafutonis

Matsumura, 1925 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Abraxas

At a glance

Occurrence records24

Data sources6

Biological traits0

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Abraxas karafutonis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF24 records

DNA & barcodingBOLD4 specimens

01Narrative

Abraxas karafutonis is een vlinder uit de familie van de spanners (Geometridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1925 door Matsumura.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abraxas karafutonis has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

226Tmostly conserved

AACATTATATTTTATCTTTGGAATTTGAGCTGGTATATTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abraxas picariasame genus6.2%Abraxas suspectasame genus6.7%Abraxas grossulariatasame genus7.4%Abraxas sublepidasame genus7.6%Abraxas virginalissame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor3

Museum / vouchered21

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 21

21 georeferenced

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	21

1 institutions · 21 of 21 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)