Abraliopsis morisii

(Vérany, 1839) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Enoploteuthidae/Abraliopsis

At a glance

Occurrence records661

Data sources9

Biological traits7

DNA specimens15

eDNA detections41

Sources9 archives

Databases and archives Abraliopsis morisii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility192 records↗

OBISOcean Biodiversity Information System469 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS661 records

Environmental DNA1 datasets · 5 countries41 detections

DNA & barcodingBOLD15 specimens

01Narrative

Abraliopsis morisii is a species of bioluminescent squid in the family Enoploteuthidae. The species occurs in tropical to warm temperate waters in the Atlantic Ocean, including the Gulf of Mexico and the Mediterranean Sea. It can be found in the epipelagic and mesopelagic zones. Jean Baptiste Vérany described the species in 1839 and it reaches lengths of 25 to. It is rated as least concern by the International Union for Conservation of Nature (IUCN).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length7 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max3 660 m

Depth min0 m

Vulnerability10

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abraliopsis morisii has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections41

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

76Avariable

79Amostly conserved

148Gvariable

277Cvariable

376Cvariable

535Gmostly conserved

AACTCTTTATTTTATCTTTGGTATCTGGTCGGGATTATTAGGTACTTCACTTAGACTAATAATTCGAACTGAATTAGGACAACCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes3

BIN1

Most divergent pair0.76%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abraliopsis tuisame genus8.7%Sepiola tridenssame order15.3%Illex coindetiisame order15.4%Illex illecebrosussame order15.7%Pyroteuthis serratasame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_082331 ↗ · 18 protein · 23 tRNA · 2 rRNA

COX3ND3COX1COX2ATP8ATP6ND2ND5ND4ND4LCYTBND6ND112S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type661 records

Wild obs. + sensor192

Museum / vouchered459

Other10

Range

Area of Occupancy AOO1 736 km²

Depth

0–200 m sunlit178

200–1000 m twilight123

1–4 km midnight45

>4 km abyssal0

median 198.7 m · max 3 417.5 m · 346 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 76

76 georeferenced · 116 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 458 without coordinates

Open the institutions mapphysical evidence459

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	69
The Atlantic reference Centrelocation not on record	28
Delaware Museum of Nature and Sciencelocation not on record	15
ICM-CSIClocation not on record	9
Saint John, CA	3
Earth Sciences New Zealandlocation not on record	2
Cambridge, US	2
UM-RSMASlocation not on record	2
IEOlocation not on record	1

9 institutions · 131 of 459 vouchered records shown · 3 without an institution code

09Environmental DNA41 detections

Where the DNA of Abraliopsis morisii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 20.6–24.1

Seasonal swing summer↔winter15.7 °C

Max temp (day)22.1 °C 21.1–25.0

Min temp (night)20.4 °C 19.8–23.2

Precipitation114 mm/mo 0.9–169

Air humidity67.0 % 64.0–78.6

Vapour deficit832 Pa 537–1,048

Cloud cover37.5 % 15.4–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)