Abraeus granulum

Erichson, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Histeridae/Abraeus

At a glance

Occurrence records1 354

Data sources5

Biological traits2

DNA specimens6

eDNA detections6

Sources5 archives

Databases and archives Abraeus granulum's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 354 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD6 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abraeus granulum has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

97Cmostly conserved

482Gmostly conserved

CACTTTATACTTCATTTTAGGTGCATGATCCGGGATAGTAGGAACCTCACTCAGATTATTAATTCGTGCCGAATTAGGTAATCCTGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neotrichonotulus perotensissame order16.9%Helophorus orientalissame order17.6%Quedius maurussame order17.6%Aleochara moerenssame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 354 records

Wild obs. + sensor762

Museum / vouchered346

Cultivated / captive17

Fossil3

Other226

Origin

Native150

Range

Area of Occupancy AOO1 732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 150≤1 km 79≤10 km 398>10 km 3

630 georeferenced · 132 without coordinates

Open the mapobservation + sensor762

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 26≤1 km 68≤10 km 174>10 km 2

270 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence346

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the mapnot free-living17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	67
Bern, CH	45
Geneva, CH	42
Bonn, DE	38
Muzeum Górnośląskie w Bytomiulocation not on record	22
MZLUlocation not on record	11
Provincia di Livornolocation not on record	10
Salzburg, AT	9
ZSMlocation not on record	8
Zürich, CH	7
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
Fribourg, CH	4
Dhaka, BD	4
Uniwersytet Wrocławskilocation not on record	4
IFR-DNFlocation not on record	3
Paro, BT	2
CBDClocation not on record	2
WULS-DFPElocation not on record	1
Copenhagen, DK	1
NMOKlocation not on record	1

20 institutions · 287 of 346 vouchered records shown · 59 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Abraeus granulum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

aus Rinden, Moos und rotfaulem Mulm an einer…Oak

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.50 °C 6.40–16.8

Seasonal swing summer↔winter15.9 °C

Max temp (day)13.4 °C 9.80–20.8

Min temp (night)4.80 °C 2.90–12.3

Precipitation64.1 mm/mo 46.4–75.1

Air humidity60.3 % 59.0–64.1

Moisture balance-23.9 mm/mo -52.7–17.8

Vapour deficit480 Pa 360–785

Wind speed3.00 m/s 3.00–4.00

Cloud cover39.8 % 33.1–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abraeus granulum

At a glance

Sources5 archives

Diet & foraging2

At a glance

Record type1 354 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 354 records